Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Adcy10'

57734

Institutional Source

Beutler Lab

Gene Symbol

Adcy10

Ensembl Gene

ENSMUSG00000026567

Gene Name

adenylate cyclase 10

Synonyms

sAC, Sacy, soluble adenylyl cyclase

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

165485183-165576774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 165543105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 651 (D651G)

Ref Sequence

ENSEMBL: ENSMUSP00000107067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]

AlphaFold

Q8C0T9

Predicted Effect

probably damaging
Transcript: ENSMUST00000027852
AA Change: D651G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: D651G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	442	2.3e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111439
AA Change: D651G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: D651G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000111440
AA Change: D651G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: D651G

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	286	420	1.9e-12	PFAM
low complexity region	838	847	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
Blast:TPR	1295	1328	6e-9	BLAST
Blast:TPR	1510	1543	7e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124037

Predicted Effect

probably benign
Transcript: ENSMUST00000148550

SMART Domains

Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
CYCc	7	206	3.27e-3	SMART
Pfam:Guanylate_cyc	285	420	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155216

SMART Domains

Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

Domain	Start	End	E-Value	Type
PDB:4OZ3\|A	1	98	2e-51	PDB
Blast:CYCc	7	98	2e-61	BLAST
SCOP:d1azsb_	43	98	9e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195194

Meta Mutation Damage Score

0.6991

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Adcy10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Adcy10	APN	1	165551914	missense	probably benign	0.45
IGL00731:Adcy10	APN	1	165572614	missense	probably benign
IGL01099:Adcy10	APN	1	165539842	missense	probably benign	0.21
IGL01464:Adcy10	APN	1	165546587	missense	probably damaging	1.00
IGL01729:Adcy10	APN	1	165513168	critical splice donor site	probably null
IGL02002:Adcy10	APN	1	165521843	missense	probably damaging	1.00
IGL02094:Adcy10	APN	1	165570620	missense	probably damaging	1.00
IGL02132:Adcy10	APN	1	165572543	missense	probably damaging	0.96
IGL02276:Adcy10	APN	1	165559128	missense	probably damaging	0.96
IGL02408:Adcy10	APN	1	165538380	missense	probably damaging	1.00
IGL02410:Adcy10	APN	1	165510408	missense	probably damaging	1.00
IGL02445:Adcy10	APN	1	165570744	missense	possibly damaging	0.85
IGL02470:Adcy10	APN	1	165567726	missense	probably damaging	1.00
IGL02551:Adcy10	APN	1	165543233	missense	probably damaging	1.00
IGL02606:Adcy10	APN	1	165519518	missense	possibly damaging	0.88
IGL02609:Adcy10	APN	1	165538475	nonsense	probably null
Bugged	UTSW	1	165564237	missense	probably damaging	0.99
debye	UTSW	1	165551361	critical splice donor site	probably null
malaysian	UTSW	1	165513127	missense	probably benign	0.38
singaporean	UTSW	1	165518312	missense	probably damaging	0.98
PIT4514001:Adcy10	UTSW	1	165556791	missense	probably benign	0.28
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0046:Adcy10	UTSW	1	165539834	missense	probably damaging	0.99
R0276:Adcy10	UTSW	1	165572591	missense	possibly damaging	0.88
R0324:Adcy10	UTSW	1	165564249	missense	probably benign	0.00
R0433:Adcy10	UTSW	1	165552022	missense	probably damaging	1.00
R0454:Adcy10	UTSW	1	165570728	missense	probably damaging	1.00
R0501:Adcy10	UTSW	1	165510390	missense	probably damaging	1.00
R0513:Adcy10	UTSW	1	165519519	missense	probably benign	0.04
R0533:Adcy10	UTSW	1	165564023	missense	probably benign	0.05
R0550:Adcy10	UTSW	1	165565315	missense	probably benign	0.00
R0554:Adcy10	UTSW	1	165513130	missense	probably benign
R0597:Adcy10	UTSW	1	165525062	critical splice donor site	probably null
R1421:Adcy10	UTSW	1	165563947	missense	probably damaging	0.98
R1454:Adcy10	UTSW	1	165515380	missense	possibly damaging	0.66
R1524:Adcy10	UTSW	1	165518403	missense	probably damaging	1.00
R1534:Adcy10	UTSW	1	165518312	missense	probably damaging	0.98
R1594:Adcy10	UTSW	1	165525033	missense	probably benign	0.02
R1690:Adcy10	UTSW	1	165519925	missense	probably damaging	1.00
R1842:Adcy10	UTSW	1	165503243	missense	probably damaging	1.00
R1859:Adcy10	UTSW	1	165521961	missense	probably damaging	1.00
R1885:Adcy10	UTSW	1	165570808	missense	probably benign	0.02
R1929:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2005:Adcy10	UTSW	1	165525022	missense	probably benign	0.02
R2211:Adcy10	UTSW	1	165518212	missense	probably damaging	1.00
R2225:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2227:Adcy10	UTSW	1	165518260	missense	probably damaging	1.00
R2272:Adcy10	UTSW	1	165510297	missense	probably damaging	1.00
R2421:Adcy10	UTSW	1	165558597	missense	probably damaging	0.97
R3614:Adcy10	UTSW	1	165575727	missense	probably benign	0.38
R4538:Adcy10	UTSW	1	165513127	missense	probably benign	0.38
R4644:Adcy10	UTSW	1	165551361	critical splice donor site	probably null
R4649:Adcy10	UTSW	1	165504049	missense	probably damaging	1.00
R4832:Adcy10	UTSW	1	165506644	missense	probably damaging	1.00
R4853:Adcy10	UTSW	1	165548213	missense	probably benign
R4916:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R4951:Adcy10	UTSW	1	165563963	missense	probably damaging	1.00
R4972:Adcy10	UTSW	1	165556862	missense	probably damaging	1.00
R5116:Adcy10	UTSW	1	165519500	missense	probably damaging	1.00
R5377:Adcy10	UTSW	1	165519895	missense	probably damaging	1.00
R5442:Adcy10	UTSW	1	165513140	missense	probably benign	0.43
R5692:Adcy10	UTSW	1	165515306	missense	probably benign	0.36
R5949:Adcy10	UTSW	1	165539817	missense	possibly damaging	0.79
R5998:Adcy10	UTSW	1	165541649	missense	probably benign	0.19
R6238:Adcy10	UTSW	1	165575728	nonsense	probably null
R6455:Adcy10	UTSW	1	165518374	missense	probably damaging	1.00
R6920:Adcy10	UTSW	1	165575658	missense	probably damaging	1.00
R6935:Adcy10	UTSW	1	165506635	missense	probably benign	0.21
R6957:Adcy10	UTSW	1	165564285	missense	probably damaging	1.00
R6970:Adcy10	UTSW	1	165556916	missense	probably benign	0.02
R7027:Adcy10	UTSW	1	165518246	missense	probably damaging	1.00
R7049:Adcy10	UTSW	1	165539874	missense	probably damaging	1.00
R7062:Adcy10	UTSW	1	165538522	missense	probably benign	0.27
R7130:Adcy10	UTSW	1	165504047	missense	probably damaging	1.00
R7144:Adcy10	UTSW	1	165510370	missense	probably benign	0.01
R7182:Adcy10	UTSW	1	165543470	splice site	probably null
R7228:Adcy10	UTSW	1	165510272	missense	probably damaging	1.00
R7384:Adcy10	UTSW	1	165576608	missense	unknown
R7561:Adcy10	UTSW	1	165559172	missense	possibly damaging	0.94
R7603:Adcy10	UTSW	1	165564237	missense	probably damaging	0.99
R7693:Adcy10	UTSW	1	165570771	missense	probably benign	0.01
R7812:Adcy10	UTSW	1	165515369	missense	probably damaging	1.00
R7905:Adcy10	UTSW	1	165513168	critical splice donor site	probably null
R8040:Adcy10	UTSW	1	165552024	missense	probably damaging	1.00
R8242:Adcy10	UTSW	1	165546549	missense	possibly damaging	0.82
R8278:Adcy10	UTSW	1	165503288	missense	probably damaging	1.00
R8282:Adcy10	UTSW	1	165510337	missense	probably benign	0.34
R8812:Adcy10	UTSW	1	165551298	missense	probably damaging	0.98
R9039:Adcy10	UTSW	1	165518345	missense	probably damaging	1.00
R9178:Adcy10	UTSW	1	165575649	missense	possibly damaging	0.79
R9244:Adcy10	UTSW	1	165543110	missense	probably benign	0.00
R9712:Adcy10	UTSW	1	165513112	missense	probably damaging	1.00
RF018:Adcy10	UTSW	1	165552109	missense	probably damaging	1.00
Z1177:Adcy10	UTSW	1	165510276	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTGAATCCGAGTTTTCTGGAGAC -3'
(R):5'- TTGCACTCATGACACAGCCTAAG -3'

Sequencing Primer
(F):5'- CAGGTGTATCCCTGAGTCAG -3'
(R):5'- TCTGATTAAGCTCAGAGCTG -3'

Posted On

2013-07-11