Incidental Mutation 'R7447:Magi1'
ID577353
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 1
SynonymsAIP3, Baiap1, BAP1, Gukmi1, WWP3
Accession Numbers

NCBI RefSeq: NM_010367.2; NM_001083320.1 NM_001029850.3, NM_001083321.1; MGI: 1203522

Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7447 (G1)
Quality Score92.0077
Status Not validated
Chromosome6
Chromosomal Location93675455-94283917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 93745581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 666 (S666R)
Ref Sequence ENSEMBL: ENSMUSP00000086730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
PDB Structure
X-ray crystal structure of MAGI-1 PDZ1 bound to the C-terminal peptide of HPV18 E6 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000055224
AA Change: S654R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095
AA Change: S654R

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089317
AA Change: S666R

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: S666R

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093769
AA Change: S439R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: S439R

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203519
AA Change: S666R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095
AA Change: S666R

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203688
AA Change: S439R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: S439R

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204347
AA Change: S666R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: S666R

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204532
AA Change: S439R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095
AA Change: S439R

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Arhgap39 G A 15: 76,765,597 probably benign Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myh1 A G 11: 67,219,180 K1398R probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Ngly1 T C 14: 16,290,844 I442T probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Rptor T A 11: 119,884,979 F992Y probably benign Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Utp20 A G 10: 88,772,492 L1561S probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94283093 missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93747224 missense probably damaging 0.99
IGL01642:Magi1 APN 6 93686624 missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93792400 unclassified probably null
IGL01967:Magi1 APN 6 93708134 missense probably damaging 1.00
IGL01984:Magi1 APN 6 93708174 missense probably damaging 1.00
IGL02074:Magi1 APN 6 93745598 missense probably damaging 1.00
IGL02098:Magi1 APN 6 93678787 missense probably damaging 1.00
IGL02225:Magi1 APN 6 93694026 missense probably damaging 1.00
IGL02522:Magi1 APN 6 93678636 missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93785610 missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93686873 missense probably damaging 1.00
P0007:Magi1 UTSW 6 93745988 missense probably damaging 1.00
R0149:Magi1 UTSW 6 93747245 missense probably damaging 1.00
R0512:Magi1 UTSW 6 93694064 missense probably damaging 1.00
R1487:Magi1 UTSW 6 93708079 missense probably benign 0.00
R1497:Magi1 UTSW 6 93747329 missense probably damaging 1.00
R1502:Magi1 UTSW 6 93694170 missense probably damaging 1.00
R1824:Magi1 UTSW 6 93699639 missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93755045 missense probably benign
R2132:Magi1 UTSW 6 93697274 missense probably damaging 0.99
R2331:Magi1 UTSW 6 93685562 missense probably damaging 1.00
R2418:Magi1 UTSW 6 93745910 missense probably damaging 1.00
R3076:Magi1 UTSW 6 93757687 missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93699629 missense probably damaging 0.98
R4005:Magi1 UTSW 6 93701318 missense probably damaging 1.00
R4455:Magi1 UTSW 6 93785457 missense probably damaging 1.00
R4670:Magi1 UTSW 6 93686643 splice site probably null
R4671:Magi1 UTSW 6 93680787 critical splice donor site probably null
R4839:Magi1 UTSW 6 93694196 missense probably damaging 1.00
R5132:Magi1 UTSW 6 93683091 critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93747267 missense probably damaging 1.00
R5525:Magi1 UTSW 6 93792373 missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93680871 missense probably benign 0.03
R5724:Magi1 UTSW 6 93745701 missense probably damaging 1.00
R5846:Magi1 UTSW 6 93685603 missense probably damaging 1.00
R5896:Magi1 UTSW 6 93708199 missense probably damaging 1.00
R5912:Magi1 UTSW 6 93708145 missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93745590 missense probably damaging 1.00
R6115:Magi1 UTSW 6 93708070 missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93943229 missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94283196 missense probably benign 0.06
R6457:Magi1 UTSW 6 93699639 missense probably damaging 1.00
R6464:Magi1 UTSW 6 93699789 missense probably damaging 1.00
R6613:Magi1 UTSW 6 93745673 missense probably damaging 1.00
R6661:Magi1 UTSW 6 93943308 missense probably benign 0.08
R6755:Magi1 UTSW 6 93708177 missense probably damaging 1.00
R6909:Magi1 UTSW 6 93697320 missense probably damaging 1.00
R7180:Magi1 UTSW 6 93815750 missense probably benign 0.10
R7224:Magi1 UTSW 6 93683089 missense probably benign 0.34
R7517:Magi1 UTSW 6 93708208 missense probably damaging 0.99
R7537:Magi1 UTSW 6 93708110 nonsense probably null
R7549:Magi1 UTSW 6 93708114 missense probably benign 0.19
R7566:Magi1 UTSW 6 93678327 missense probably benign 0.03
R7805:Magi1 UTSW 6 93682946 missense probably benign
R8022:Magi1 UTSW 6 93697365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGTTCGAACGCAGAG -3'
(R):5'- CAGGCAAAGTCAGCAGCATG -3'

Sequencing Primer
(F):5'- TTCGAACGCAGAGAACAAAGTC -3'
(R):5'- CTGCTGATGTGGCTTCCAACAG -3'
Posted On2019-10-07