Mutagenetix > Incidental Mutations

Incidental Mutation 'R7447:Tigar'

577356

Institutional Source

Beutler Lab

Gene Symbol

Tigar

Ensembl Gene

ENSMUSG00000038028

Gene Name

Trp53 induced glycolysis repulatory phosphatase

Synonyms

9630033F20Rik, Tigar

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127085116-127109557 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127088166 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 173 (G173E)

Ref Sequence

ENSEMBL: ENSMUSP00000048643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039913] [ENSMUST00000200988]

Predicted Effect

probably benign
Transcript: ENSMUST00000039913
AA Change: G173E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000048643
Gene: ENSMUSG00000038028
AA Change: G173E

Domain	Start	End	E-Value	Type
PGAM	5	205	8.71e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200988

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit improved response to myocardial infarction associated with increased autophagy, mitophagy, levels of reactive oxygen species production and decreased mitochondria DNA damage. Mice homozygous for a different allele exhibit impaired crypt regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	T	C	11: 29,824,122	D445G	probably benign	Het
Adck5	A	T	15: 76,595,196	I484F	possibly damaging	Het
Ago2	A	T	15: 73,138,032	N100K	probably benign	Het
Appl1	T	A	14: 26,959,452	K130*	probably null	Het
Arhgap39	G	A	15: 76,765,597		probably benign	Het
Axdnd1	A	G	1: 156,418,232		probably null	Het
C77080	C	A	4: 129,222,042	R988L	possibly damaging	Het
Camta1	A	T	4: 151,083,870	V1332E	probably benign	Het
Cd3g	A	G	9: 44,973,559	L129P	probably damaging	Het
Cd80	T	G	16: 38,473,889	S45A	probably benign	Het
Cdk12	A	T	11: 98,245,280	Q1120L	unknown	Het
Clip1	G	A	5: 123,653,633	S158F	probably benign	Het
Cntn3	C	A	6: 102,278,455	E161*	probably null	Het
Cyp3a59	A	C	5: 146,087,405	K67T	probably benign	Het
Dmxl1	T	C	18: 49,864,614	L623P	probably damaging	Het
Drd3	T	A	16: 43,817,063	Y208*	probably null	Het
Dusp10	A	T	1: 184,068,956	M307L	probably benign	Het
Dync2li1	A	T	17: 84,647,713	I267L	possibly damaging	Het
Edn3	C	A	2: 174,761,751	C97*	probably null	Het
Ehbp1l1	T	A	19: 5,719,428	T616S	possibly damaging	Het
Eif2a	C	T	3: 58,545,542	T246I	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Errfi1	A	G	4: 150,866,651	T179A	probably damaging	Het
Esyt3	G	A	9: 99,321,562	L450F	probably damaging	Het
Evx2	A	G	2: 74,659,104	S106P	probably benign	Het
Fam83a	T	G	15: 58,009,690	V305G	probably benign	Het
Gpr171	T	A	3: 59,098,439		probably null	Het
Grip1	A	G	10: 120,086,966	T1106A	probably benign	Het
Hecw1	A	G	13: 14,357,204	Y162H	probably damaging	Het
Hephl1	C	T	9: 15,097,882		probably null	Het
Hsp90aa1	A	G	12: 110,692,128	I693T	possibly damaging	Het
Ifit1bl2	T	A	19: 34,619,574	D214V	probably damaging	Het
Igsf10	T	C	3: 59,331,801	M320V	probably benign	Het
Kcnq2	A	G	2: 181,113,094	L220P	probably damaging	Het
Kpna1	C	A	16: 36,029,639	Q372K	probably damaging	Het
Lilrb4a	T	G	10: 51,491,053		probably null	Het
Ly75	C	A	2: 60,334,474	E787*	probably null	Het
Magi1	T	G	6: 93,745,581	S666R	possibly damaging	Het
Mif	C	A	10: 75,859,853	A39S	possibly damaging	Het
Mob4	G	A	1: 55,131,466		probably benign	Het
Mtmr4	G	T	11: 87,611,901	C927F	probably damaging	Het
Myh1	A	G	11: 67,219,180	K1398R	probably benign	Het
Myo3a	T	C	2: 22,544,426	V873A	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	G	A	15: 99,427,476	P382L	probably damaging	Het
Ngly1	T	C	14: 16,290,844	I442T	probably damaging	Het
Nlrp1a	T	C	11: 71,092,411	Y1243C	probably damaging	Het
Olfr1055	T	A	2: 86,346,806	H320L	possibly damaging	Het
Pcsk5	C	T	19: 17,510,236	G1027D	probably benign	Het
Pla2g2c	T	A	4: 138,731,616	I11N	probably benign	Het
Polr3d	A	G	14: 70,439,800	I331T	probably damaging	Het
Ppp4r4	A	G	12: 103,585,726	I293M	possibly damaging	Het
Prkce	G	T	17: 86,559,259	V516F	probably damaging	Het
Prss27	T	A	17: 24,045,709	L282Q	probably damaging	Het
Pxdn	A	G	12: 29,984,927	Y261C	probably damaging	Het
R3hcc1l	T	C	19: 42,562,662	S33P	probably benign	Het
Rab11fip3	G	C	17: 26,068,874	R102G	possibly damaging	Het
Rabggta	A	T	14: 55,719,316	N310K	probably null	Het
Rbbp8	T	A	18: 11,660,877	D15E	probably benign	Het
Rbm5	T	C	9: 107,746,179	Y486C	probably damaging	Het
Rptor	T	A	11: 119,884,979	F992Y	probably benign	Het
Slc29a2	T	G	19: 5,026,417	L111R	probably damaging	Het
Slc39a11	T	A	11: 113,562,023	I31L	probably benign	Het
Slc6a20a	T	A	9: 123,656,224	N311I	possibly damaging	Het
Slc8a1	A	G	17: 81,649,006	F201S	probably damaging	Het
Smtn	C	A	11: 3,530,196	V342L	probably benign	Het
Syne2	A	G	12: 76,028,079	T4598A	probably benign	Het
Tchp	A	G	5: 114,715,655	T267A	probably benign	Het
Tctex1d2	T	A	16: 32,425,271	V95E	probably damaging	Het
Tes3-ps	A	G	13: 49,494,032	E128G	possibly damaging	Het
Tmem171	T	C	13: 98,688,354	N256S	probably benign	Het
Tmem204	A	G	17: 25,058,296	I205T	probably damaging	Het
Tmem63a	A	G	1: 180,958,023	K240R	probably benign	Het
Tns2	C	T	15: 102,110,916	T446M	probably damaging	Het
Tnxb	A	T	17: 34,718,470	N2931I	probably damaging	Het
Trrap	G	T	5: 144,839,474	R2941L	probably damaging	Het
Ttc8	A	T	12: 98,943,872	R179S	probably damaging	Het
Ttll12	G	T	15: 83,586,975	T234N	probably damaging	Het
Ttn	G	T	2: 76,747,232	T24439K	probably damaging	Het
Ube2z	A	T	11: 96,055,910	I246N	possibly damaging	Het
Usp15	A	G	10: 123,175,881	Y104H	probably damaging	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp5	G	A	6: 124,821,114	A436V	probably damaging	Het
Utp20	A	G	10: 88,772,492	L1561S	probably damaging	Het
Xrn1	A	G	9: 96,045,494	M1444V	probably benign	Het
Zfp236	G	T	18: 82,633,690	Q885K	probably damaging	Het
Zfp831	C	A	2: 174,646,103	P857Q	possibly damaging	Het

Other mutations in Tigar

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Tigar	APN	6	127088079	missense	probably damaging	0.98
IGL01099:Tigar	APN	6	127088145	missense	probably benign
IGL02021:Tigar	APN	6	127089290	missense	probably damaging	0.97
R0356:Tigar	UTSW	6	127091182	critical splice donor site	probably null
R1972:Tigar	UTSW	6	127087926	missense	possibly damaging	0.62
R5492:Tigar	UTSW	6	127089204	missense	possibly damaging	0.80
R6063:Tigar	UTSW	6	127091201	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACGCACTGAATCGATGGC -3'
(R):5'- CAAGTGATGCTTTGAAGTCCC -3'

Sequencing Primer
(F):5'- GCTTCCTCACAGTCTATGATGAAGAC -3'
(R):5'- GATGCTTTGAAGTCCCATAGAAACC -3'

Posted On

2019-10-07