Incidental Mutation 'R7447:Utp20'
ID577366
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7447 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88772492 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1561 (L1561S)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: L1561S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: L1561S

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219662
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Arhgap39 G A 15: 76,765,597 probably benign Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Magi1 T G 6: 93,745,581 S666R possibly damaging Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myh1 A G 11: 67,219,180 K1398R probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Ngly1 T C 14: 16,290,844 I442T probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Rptor T A 11: 119,884,979 F992Y probably benign Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAAGAACCCTGAAGCCTTC -3'
(R):5'- ACTGTCACAAGTTTTCTGGGG -3'

Sequencing Primer
(F):5'- TGAAGCCTTCTTGAAACCCC -3'
(R):5'- TCTTTTCTTACAGTGGAAGAAATGG -3'
Posted On2019-10-07