Incidental Mutation 'R0629:Olfr1086'
ID57737
Institutional Source Beutler Lab
Gene Symbol Olfr1086
Ensembl Gene ENSMUSG00000075175
Gene Nameolfactory receptor 1086
SynonymsGA_x6K02T2Q125-48168771-48167839, MOR179-2
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86676218-86680092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86676529 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 268 (H268L)
Ref Sequence ENSEMBL: ENSMUSP00000150094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099878] [ENSMUST00000213198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099878
AA Change: H268L

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097463
Gene: ENSMUSG00000075175
AA Change: H268L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-49 PFAM
Pfam:7tm_1 39 288 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213198
AA Change: H268L

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.5091 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Olfr1086
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1086 APN 2 86677081 missense probably benign 0.00
R0492:Olfr1086 UTSW 2 86676490 missense probably damaging 1.00
R1114:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R1341:Olfr1086 UTSW 2 86677163 missense possibly damaging 0.86
R1868:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R2183:Olfr1086 UTSW 2 86677036 missense probably benign 0.21
R3159:Olfr1086 UTSW 2 86676511 missense probably benign 0.03
R4061:Olfr1086 UTSW 2 86676818 missense probably damaging 1.00
R4420:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R5514:Olfr1086 UTSW 2 86676881 missense probably benign 0.03
R7066:Olfr1086 UTSW 2 86677226 missense possibly damaging 0.95
R7077:Olfr1086 UTSW 2 86676892 missense possibly damaging 0.78
R7246:Olfr1086 UTSW 2 86677289 missense probably benign 0.11
R7383:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
X0064:Olfr1086 UTSW 2 86677199 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTCTTTCAAATGTGTGACCACT -3'
(R):5'- TGATTGTCCTGCTGTCCTATGGCTT -3'

Sequencing Primer
(F):5'- ACAGGAGAGGCATTAACTAATACC -3'
(R):5'- GCTGTCCTATGGCTTCATTTTG -3'
Posted On2013-07-11