Incidental Mutation 'R7447:Myh1'
ID577371
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7447 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67219180 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1398 (K1398R)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
Predicted Effect probably benign
Transcript: ENSMUST00000018637
AA Change: K1398R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: K1398R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
AA Change: K1398R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: K1398R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
AA Change: K1398R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: K1398R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Arhgap39 G A 15: 76,765,597 probably benign Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Magi1 T G 6: 93,745,581 S666R possibly damaging Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Ngly1 T C 14: 16,290,844 I442T probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Rptor T A 11: 119,884,979 F992Y probably benign Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Utp20 A G 10: 88,772,492 L1561S probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R0964:Myh1 UTSW 11 67205925 missense probably benign
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTATGCTGAAATGTGGCTGC -3'
(R):5'- GGTTCTAGAAGCACACCTTGTC -3'

Sequencing Primer
(F):5'- ACTATGCTGAAATGTGGCTGCATTTG -3'
(R):5'- GAAGCACACCTTGTCAAAGTTTCTC -3'
Posted On2019-10-07