Incidental Mutation 'R7447:Rptor'
ID577377
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Nameregulatory associated protein of MTOR, complex 1
Synonymsraptor, Rap, 4932417H02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7447 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119602905-119899576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119884979 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 992 (F992Y)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000131217] [ENSMUST00000147781]
Predicted Effect probably benign
Transcript: ENSMUST00000026671
AA Change: F992Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: F992Y

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131217
SMART Domains Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136662
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Arhgap39 G A 15: 76,765,597 probably benign Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Magi1 T G 6: 93,745,581 S666R possibly damaging Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myh1 A G 11: 67,219,180 K1398R probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Ngly1 T C 14: 16,290,844 I442T probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Utp20 A G 10: 88,772,492 L1561S probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119799445 missense possibly damaging 0.92
IGL01319:Rptor APN 11 119891170 missense probably benign 0.01
IGL01375:Rptor APN 11 119896436 missense possibly damaging 0.68
IGL01899:Rptor APN 11 119857453 missense probably benign 0.04
IGL01927:Rptor APN 11 119657674 missense probably damaging 1.00
IGL02312:Rptor APN 11 119846915 missense possibly damaging 0.84
IGL02620:Rptor APN 11 119780587 missense probably benign 0.12
IGL02651:Rptor APN 11 119892612 missense possibly damaging 0.69
IGL03182:Rptor APN 11 119725145 missense probably damaging 1.00
Velocipede UTSW 11 119895977 missense possibly damaging 0.92
R0103:Rptor UTSW 11 119884967 missense probably benign 0.01
R0179:Rptor UTSW 11 119872367 missense probably benign 0.14
R0217:Rptor UTSW 11 119894912 splice site probably benign
R0219:Rptor UTSW 11 119821777 intron probably benign
R0324:Rptor UTSW 11 119892641 missense probably damaging 1.00
R0432:Rptor UTSW 11 119780553 nonsense probably null
R0718:Rptor UTSW 11 119872376 missense probably benign 0.15
R0730:Rptor UTSW 11 119884954 missense probably benign 0.06
R1019:Rptor UTSW 11 119843743 missense probably damaging 1.00
R1073:Rptor UTSW 11 119743891 missense possibly damaging 0.93
R1424:Rptor UTSW 11 119780593 nonsense probably null
R1579:Rptor UTSW 11 119896001 missense probably benign 0.00
R1766:Rptor UTSW 11 119725061 missense probably damaging 0.99
R1844:Rptor UTSW 11 119756320 missense probably damaging 1.00
R2180:Rptor UTSW 11 119725144 missense probably damaging 1.00
R2274:Rptor UTSW 11 119756322 nonsense probably null
R2275:Rptor UTSW 11 119756322 nonsense probably null
R2408:Rptor UTSW 11 119857451 missense probably damaging 0.99
R2981:Rptor UTSW 11 119865594 missense probably damaging 1.00
R2996:Rptor UTSW 11 119856298 missense probably damaging 1.00
R3001:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3002:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3003:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R4358:Rptor UTSW 11 119671345 missense probably damaging 0.98
R4592:Rptor UTSW 11 119798840 missense probably null 1.00
R4647:Rptor UTSW 11 119891163 missense probably benign 0.33
R4666:Rptor UTSW 11 119743882 missense probably damaging 1.00
R4958:Rptor UTSW 11 119857391 missense probably benign 0.29
R4974:Rptor UTSW 11 119821640 intron probably benign
R5073:Rptor UTSW 11 119896479 missense possibly damaging 0.71
R5199:Rptor UTSW 11 119603816 missense probably benign
R5216:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5219:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5277:Rptor UTSW 11 119822956 missense probably damaging 1.00
R5365:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5366:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5447:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5630:Rptor UTSW 11 119756249 missense probably benign 0.01
R6220:Rptor UTSW 11 119897442 missense possibly damaging 0.83
R6567:Rptor UTSW 11 119896012 missense probably benign 0.00
R6741:Rptor UTSW 11 119895977 missense possibly damaging 0.92
R6915:Rptor UTSW 11 119756345 missense probably damaging 0.99
R7032:Rptor UTSW 11 119846936 missense probably benign 0.00
R7051:Rptor UTSW 11 119874186 utr 3 prime probably benign
R7396:Rptor UTSW 11 119872355 missense probably benign 0.10
R7429:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7430:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7595:Rptor UTSW 11 119743953 missense possibly damaging 0.82
R7776:Rptor UTSW 11 119892627 missense probably benign 0.01
R7854:Rptor UTSW 11 119857953 missense probably benign 0.02
R8288:Rptor UTSW 11 119857937 missense probably benign 0.02
R8305:Rptor UTSW 11 119811986 missense probably damaging 1.00
R8328:Rptor UTSW 11 119892647 missense probably benign 0.00
R8351:Rptor UTSW 11 119892639 missense probably benign 0.22
R8772:Rptor UTSW 11 119725032 missense probably damaging 1.00
R8871:Rptor UTSW 11 119603925 missense probably benign 0.01
X0050:Rptor UTSW 11 119846405 missense probably benign 0.14
X0066:Rptor UTSW 11 119857866 missense probably benign 0.31
Z0001:Rptor UTSW 11 119603972 critical splice donor site probably null
Z0001:Rptor UTSW 11 119756236 splice site probably null
Z0001:Rptor UTSW 11 119756415 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119799319 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119846752 critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119851468 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119857453 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119871492 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119874151 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119896549 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAGAGTAATGGCGTGTG -3'
(R):5'- AAGGTCACAGCTCCTTGAGG -3'

Sequencing Primer
(F):5'- GACACAGTTCTCTATGTAGCCCAGG -3'
(R):5'- TCCCCCTGAGGCAGTTC -3'
Posted On2019-10-07