Incidental Mutation 'R7447:Ngly1'
ID577388
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene NameN-glycanase 1
SynonymsPng1, PNGase, 1110002C09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R7447 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location16249280-16311926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16290844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 442 (I442T)
Ref Sequence ENSEMBL: ENSMUSP00000022310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000224656]
PDB Structure
Solution structure of the N-terminal portion of the PUB domain of mouse peptide:N-glycanase [SOLUTION NMR]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Crystal structure of intein-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of His-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of the PUB domain of mouse PNGase [X-RAY DIFFRACTION]
Crystal structure of the mouse p97/PNGase complex [X-RAY DIFFRACTION]
Crystal structure of mouse Peptide N-Glycanase C-terminal domain in complex with mannopentaose [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022310
AA Change: I442T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: I442T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224656
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Arhgap39 G A 15: 76,765,597 probably benign Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Magi1 T G 6: 93,745,581 S666R possibly damaging Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myh1 A G 11: 67,219,180 K1398R probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Rptor T A 11: 119,884,979 F992Y probably benign Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Utp20 A G 10: 88,772,492 L1561S probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16290873 missense probably benign 0.14
IGL02199:Ngly1 APN 14 16290844 missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16281791 missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16290939 intron probably benign
IGL03209:Ngly1 APN 14 16281831 nonsense probably null
IGL03290:Ngly1 APN 14 16281866 missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16260636 missense probably benign
R0518:Ngly1 UTSW 14 16290774 nonsense probably null
R0521:Ngly1 UTSW 14 16290774 nonsense probably null
R1612:Ngly1 UTSW 14 16290867 nonsense probably null
R1851:Ngly1 UTSW 14 16260585 missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16277877 missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16290721 intron probably null
R2696:Ngly1 UTSW 14 16283439 missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16290766 intron probably benign
R3883:Ngly1 UTSW 14 16270574 missense probably damaging 1.00
R4700:Ngly1 UTSW 14 16281809 missense probably benign 0.01
R5160:Ngly1 UTSW 14 16281751 missense probably damaging 0.98
R5555:Ngly1 UTSW 14 16270508 nonsense probably null
R5603:Ngly1 UTSW 14 16260762 missense probably benign 0.01
R5764:Ngly1 UTSW 14 16260799 missense probably benign
R5980:Ngly1 UTSW 14 16270509 missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16294634 missense probably benign 0.01
R6887:Ngly1 UTSW 14 16281836 missense probably benign 0.02
R6943:Ngly1 UTSW 14 16283467 missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16283445 missense probably damaging 1.00
R7748:Ngly1 UTSW 14 16290820 missense possibly damaging 0.62
X0053:Ngly1 UTSW 14 16254743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCCCATTTTAAAGCTGC -3'
(R):5'- TATATACTACTCATACAATCTCCCAGG -3'

Sequencing Primer
(F):5'- GCTGCAATAATCCAGGTCATG -3'
(R):5'- GGAAGAAAACTCTCATCACCTAGG -3'
Posted On2019-10-07