Mutagenetix > Incidental Mutations

Incidental Mutation 'R7447:Ngly1'

577388

Institutional Source

Beutler Lab

Gene Symbol

Ngly1

Ensembl Gene

ENSMUSG00000021785

Gene Name

N-glycanase 1

Synonyms

Png1, PNGase, 1110002C09Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.820) question?

Stock #

R7447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16249280-16311926 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16290844 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 442 (I442T)

Ref Sequence

ENSEMBL: ENSMUSP00000022310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000224656]

PDB Structure

Solution structure of the N-terminal portion of the PUB domain of mouse peptide:N-glycanase [SOLUTION NMR]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Crystal structure of intein-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of His-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of the PUB domain of mouse PNGase [X-RAY DIFFRACTION]
Crystal structure of the mouse p97/PNGase complex [X-RAY DIFFRACTION]
Crystal structure of mouse Peptide N-Glycanase C-terminal domain in complex with mannopentaose [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022310
AA Change: I442T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: I442T

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
PUG	30	91	1.83e-22	SMART
TGc	298	353	6.19e-14	SMART
Blast:PAW	376	415	2e-15	BLAST
low complexity region	416	433	N/A	INTRINSIC
Blast:PAW	434	472	3e-15	BLAST
PAW	484	576	1.05e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224656

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	T	C	11: 29,824,122	D445G	probably benign	Het
Adck5	A	T	15: 76,595,196	I484F	possibly damaging	Het
Ago2	A	T	15: 73,138,032	N100K	probably benign	Het
Appl1	T	A	14: 26,959,452	K130*	probably null	Het
Arhgap39	G	A	15: 76,765,597		probably benign	Het
Axdnd1	A	G	1: 156,418,232		probably null	Het
C77080	C	A	4: 129,222,042	R988L	possibly damaging	Het
Camta1	A	T	4: 151,083,870	V1332E	probably benign	Het
Cd3g	A	G	9: 44,973,559	L129P	probably damaging	Het
Cd80	T	G	16: 38,473,889	S45A	probably benign	Het
Cdk12	A	T	11: 98,245,280	Q1120L	unknown	Het
Clip1	G	A	5: 123,653,633	S158F	probably benign	Het
Cntn3	C	A	6: 102,278,455	E161*	probably null	Het
Cyp3a59	A	C	5: 146,087,405	K67T	probably benign	Het
Dmxl1	T	C	18: 49,864,614	L623P	probably damaging	Het
Drd3	T	A	16: 43,817,063	Y208*	probably null	Het
Dusp10	A	T	1: 184,068,956	M307L	probably benign	Het
Dync2li1	A	T	17: 84,647,713	I267L	possibly damaging	Het
Edn3	C	A	2: 174,761,751	C97*	probably null	Het
Ehbp1l1	T	A	19: 5,719,428	T616S	possibly damaging	Het
Eif2a	C	T	3: 58,545,542	T246I	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Errfi1	A	G	4: 150,866,651	T179A	probably damaging	Het
Esyt3	G	A	9: 99,321,562	L450F	probably damaging	Het
Evx2	A	G	2: 74,659,104	S106P	probably benign	Het
Fam83a	T	G	15: 58,009,690	V305G	probably benign	Het
Gpr171	T	A	3: 59,098,439		probably null	Het
Grip1	A	G	10: 120,086,966	T1106A	probably benign	Het
Hecw1	A	G	13: 14,357,204	Y162H	probably damaging	Het
Hephl1	C	T	9: 15,097,882		probably null	Het
Hsp90aa1	A	G	12: 110,692,128	I693T	possibly damaging	Het
Ifit1bl2	T	A	19: 34,619,574	D214V	probably damaging	Het
Igsf10	T	C	3: 59,331,801	M320V	probably benign	Het
Kcnq2	A	G	2: 181,113,094	L220P	probably damaging	Het
Kpna1	C	A	16: 36,029,639	Q372K	probably damaging	Het
Lilrb4a	T	G	10: 51,491,053		probably null	Het
Ly75	C	A	2: 60,334,474	E787*	probably null	Het
Magi1	T	G	6: 93,745,581	S666R	possibly damaging	Het
Mif	C	A	10: 75,859,853	A39S	possibly damaging	Het
Mob4	G	A	1: 55,131,466		probably benign	Het
Mtmr4	G	T	11: 87,611,901	C927F	probably damaging	Het
Myh1	A	G	11: 67,219,180	K1398R	probably benign	Het
Myo3a	T	C	2: 22,544,426	V873A	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	G	A	15: 99,427,476	P382L	probably damaging	Het
Nlrp1a	T	C	11: 71,092,411	Y1243C	probably damaging	Het
Olfr1055	T	A	2: 86,346,806	H320L	possibly damaging	Het
Pcsk5	C	T	19: 17,510,236	G1027D	probably benign	Het
Pla2g2c	T	A	4: 138,731,616	I11N	probably benign	Het
Polr3d	A	G	14: 70,439,800	I331T	probably damaging	Het
Ppp4r4	A	G	12: 103,585,726	I293M	possibly damaging	Het
Prkce	G	T	17: 86,559,259	V516F	probably damaging	Het
Prss27	T	A	17: 24,045,709	L282Q	probably damaging	Het
Pxdn	A	G	12: 29,984,927	Y261C	probably damaging	Het
R3hcc1l	T	C	19: 42,562,662	S33P	probably benign	Het
Rab11fip3	G	C	17: 26,068,874	R102G	possibly damaging	Het
Rabggta	A	T	14: 55,719,316	N310K	probably null	Het
Rbbp8	T	A	18: 11,660,877	D15E	probably benign	Het
Rbm5	T	C	9: 107,746,179	Y486C	probably damaging	Het
Rptor	T	A	11: 119,884,979	F992Y	probably benign	Het
Slc29a2	T	G	19: 5,026,417	L111R	probably damaging	Het
Slc39a11	T	A	11: 113,562,023	I31L	probably benign	Het
Slc6a20a	T	A	9: 123,656,224	N311I	possibly damaging	Het
Slc8a1	A	G	17: 81,649,006	F201S	probably damaging	Het
Smtn	C	A	11: 3,530,196	V342L	probably benign	Het
Syne2	A	G	12: 76,028,079	T4598A	probably benign	Het
Tchp	A	G	5: 114,715,655	T267A	probably benign	Het
Tctex1d2	T	A	16: 32,425,271	V95E	probably damaging	Het
Tes3-ps	A	G	13: 49,494,032	E128G	possibly damaging	Het
Tigar	C	T	6: 127,088,166	G173E	probably benign	Het
Tmem171	T	C	13: 98,688,354	N256S	probably benign	Het
Tmem204	A	G	17: 25,058,296	I205T	probably damaging	Het
Tmem63a	A	G	1: 180,958,023	K240R	probably benign	Het
Tns2	C	T	15: 102,110,916	T446M	probably damaging	Het
Tnxb	A	T	17: 34,718,470	N2931I	probably damaging	Het
Trrap	G	T	5: 144,839,474	R2941L	probably damaging	Het
Ttc8	A	T	12: 98,943,872	R179S	probably damaging	Het
Ttll12	G	T	15: 83,586,975	T234N	probably damaging	Het
Ttn	G	T	2: 76,747,232	T24439K	probably damaging	Het
Ube2z	A	T	11: 96,055,910	I246N	possibly damaging	Het
Usp15	A	G	10: 123,175,881	Y104H	probably damaging	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp5	G	A	6: 124,821,114	A436V	probably damaging	Het
Utp20	A	G	10: 88,772,492	L1561S	probably damaging	Het
Xrn1	A	G	9: 96,045,494	M1444V	probably benign	Het
Zfp236	G	T	18: 82,633,690	Q885K	probably damaging	Het
Zfp831	C	A	2: 174,646,103	P857Q	possibly damaging	Het

Other mutations in Ngly1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01807:Ngly1	APN	14	16290873	missense	probably benign	0.14
IGL02199:Ngly1	APN	14	16290844	missense	probably damaging	0.96
IGL02809:Ngly1	APN	14	16281791	missense	probably damaging	1.00
IGL02865:Ngly1	APN	14	16290939	intron	probably benign
IGL03209:Ngly1	APN	14	16281831	nonsense	probably null
IGL03290:Ngly1	APN	14	16281866	missense	probably damaging	0.98
IGL02799:Ngly1	UTSW	14	16260636	missense	probably benign
R0518:Ngly1	UTSW	14	16290774	nonsense	probably null
R0521:Ngly1	UTSW	14	16290774	nonsense	probably null
R1612:Ngly1	UTSW	14	16290867	nonsense	probably null
R1851:Ngly1	UTSW	14	16260585	missense	probably damaging	1.00
R2060:Ngly1	UTSW	14	16277877	missense	possibly damaging	0.72
R2424:Ngly1	UTSW	14	16290721	splice site	probably null
R2696:Ngly1	UTSW	14	16283439	missense	possibly damaging	0.52
R3834:Ngly1	UTSW	14	16290766	intron	probably benign
R3883:Ngly1	UTSW	14	16270574	missense	probably damaging	1.00
R4700:Ngly1	UTSW	14	16281809	missense	probably benign	0.01
R5160:Ngly1	UTSW	14	16281751	missense	probably damaging	0.98
R5555:Ngly1	UTSW	14	16270508	nonsense	probably null
R5603:Ngly1	UTSW	14	16260762	missense	probably benign	0.01
R5764:Ngly1	UTSW	14	16260799	missense	probably benign
R5980:Ngly1	UTSW	14	16270509	missense	possibly damaging	0.85
R6066:Ngly1	UTSW	14	16294634	missense	probably benign	0.01
R6887:Ngly1	UTSW	14	16281836	missense	probably benign	0.02
R6943:Ngly1	UTSW	14	16283467	missense	probably damaging	1.00
R7101:Ngly1	UTSW	14	16283445	missense	probably damaging	1.00
R7748:Ngly1	UTSW	14	16290820	missense	possibly damaging	0.62
R8123:Ngly1	UTSW	14	16260799	missense	probably benign
R8482:Ngly1	UTSW	14	16310377	missense	probably benign	0.00
X0053:Ngly1	UTSW	14	16254743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGCCCATTTTAAAGCTGC -3'
(R):5'- TATATACTACTCATACAATCTCCCAGG -3'

Sequencing Primer
(F):5'- GCTGCAATAATCCAGGTCATG -3'
(R):5'- GGAAGAAAACTCTCATCACCTAGG -3'

Posted On

2019-10-07