Incidental Mutation 'R7447:Appl1'
ID 577389
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R7447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 26640943-26692567 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 26681409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 130 (K130*)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect probably null
Transcript: ENSMUST00000036570
AA Change: K130*
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: K130*

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A T 15: 76,479,396 (GRCm39) I484F possibly damaging Het
Ago2 A T 15: 73,009,881 (GRCm39) N100K probably benign Het
Arhgap39 G A 15: 76,649,797 (GRCm39) probably benign Het
Axdnd1 A G 1: 156,245,802 (GRCm39) probably null Het
Camta1 A T 4: 151,168,327 (GRCm39) V1332E probably benign Het
Cd3g A G 9: 44,884,857 (GRCm39) L129P probably damaging Het
Cd80 T G 16: 38,294,251 (GRCm39) S45A probably benign Het
Cdk12 A T 11: 98,136,106 (GRCm39) Q1120L unknown Het
Clip1 G A 5: 123,791,696 (GRCm39) S158F probably benign Het
Cntn3 C A 6: 102,255,416 (GRCm39) E161* probably null Het
Cyp3a59 A C 5: 146,024,215 (GRCm39) K67T probably benign Het
Dmxl1 T C 18: 49,997,681 (GRCm39) L623P probably damaging Het
Drd3 T A 16: 43,637,426 (GRCm39) Y208* probably null Het
Dusp10 A T 1: 183,801,153 (GRCm39) M307L probably benign Het
Dync2li1 A T 17: 84,955,141 (GRCm39) I267L possibly damaging Het
Dynlt2b T A 16: 32,244,089 (GRCm39) V95E probably damaging Het
Edn3 C A 2: 174,603,544 (GRCm39) C97* probably null Het
Ehbp1l1 T A 19: 5,769,456 (GRCm39) T616S possibly damaging Het
Eif2a C T 3: 58,452,963 (GRCm39) T246I probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Errfi1 A G 4: 150,951,108 (GRCm39) T179A probably damaging Het
Esyt3 G A 9: 99,203,615 (GRCm39) L450F probably damaging Het
Evx2 A G 2: 74,489,448 (GRCm39) S106P probably benign Het
Fam83a T G 15: 57,873,086 (GRCm39) V305G probably benign Het
Fem1al T C 11: 29,774,122 (GRCm39) D445G probably benign Het
Gpr171 T A 3: 59,005,860 (GRCm39) probably null Het
Grip1 A G 10: 119,922,871 (GRCm39) T1106A probably benign Het
Hecw1 A G 13: 14,531,789 (GRCm39) Y162H probably damaging Het
Hephl1 C T 9: 15,009,178 (GRCm39) probably null Het
Hsp90aa1 A G 12: 110,658,562 (GRCm39) I693T possibly damaging Het
Ifit1bl2 T A 19: 34,596,974 (GRCm39) D214V probably damaging Het
Igsf10 T C 3: 59,239,222 (GRCm39) M320V probably benign Het
Kcnq2 A G 2: 180,754,887 (GRCm39) L220P probably damaging Het
Kpna1 C A 16: 35,850,009 (GRCm39) Q372K probably damaging Het
Lilrb4a T G 10: 51,367,149 (GRCm39) probably null Het
Ly75 C A 2: 60,164,818 (GRCm39) E787* probably null Het
Magi1 T G 6: 93,722,562 (GRCm39) S666R possibly damaging Het
Mif C A 10: 75,695,687 (GRCm39) A39S possibly damaging Het
Mob4 G A 1: 55,170,625 (GRCm39) probably benign Het
Mtmr4 G T 11: 87,502,727 (GRCm39) C927F probably damaging Het
Myh1 A G 11: 67,110,006 (GRCm39) K1398R probably benign Het
Myo3a T C 2: 22,436,464 (GRCm39) V873A probably benign Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nckap5l G A 15: 99,325,357 (GRCm39) P382L probably damaging Het
Ngly1 T C 14: 16,290,844 (GRCm38) I442T probably damaging Het
Nhsl3 C A 4: 129,115,835 (GRCm39) R988L possibly damaging Het
Nlrp1a T C 11: 70,983,237 (GRCm39) Y1243C probably damaging Het
Or8k53 T A 2: 86,177,150 (GRCm39) H320L possibly damaging Het
Pcsk5 C T 19: 17,487,600 (GRCm39) G1027D probably benign Het
Pla2g2c T A 4: 138,458,927 (GRCm39) I11N probably benign Het
Polr3d A G 14: 70,677,240 (GRCm39) I331T probably damaging Het
Ppp4r4 A G 12: 103,551,985 (GRCm39) I293M possibly damaging Het
Prkce G T 17: 86,866,687 (GRCm39) V516F probably damaging Het
Prss27 T A 17: 24,264,683 (GRCm39) L282Q probably damaging Het
Pxdn A G 12: 30,034,926 (GRCm39) Y261C probably damaging Het
R3hcc1l T C 19: 42,551,101 (GRCm39) S33P probably benign Het
Rab11fip3 G C 17: 26,287,848 (GRCm39) R102G possibly damaging Het
Rabggta A T 14: 55,956,773 (GRCm39) N310K probably null Het
Rbbp8 T A 18: 11,793,934 (GRCm39) D15E probably benign Het
Rbm5 T C 9: 107,623,378 (GRCm39) Y486C probably damaging Het
Rptor T A 11: 119,775,805 (GRCm39) F992Y probably benign Het
Slc29a2 T G 19: 5,076,445 (GRCm39) L111R probably damaging Het
Slc39a11 T A 11: 113,452,849 (GRCm39) I31L probably benign Het
Slc6a20a T A 9: 123,485,289 (GRCm39) N311I possibly damaging Het
Slc8a1 A G 17: 81,956,435 (GRCm39) F201S probably damaging Het
Smtn C A 11: 3,480,196 (GRCm39) V342L probably benign Het
Syne2 A G 12: 76,074,853 (GRCm39) T4598A probably benign Het
Tchp A G 5: 114,853,716 (GRCm39) T267A probably benign Het
Tes3-ps A G 13: 49,647,508 (GRCm39) E128G possibly damaging Het
Tigar C T 6: 127,065,129 (GRCm39) G173E probably benign Het
Tmem171 T C 13: 98,824,862 (GRCm39) N256S probably benign Het
Tmem204 A G 17: 25,277,270 (GRCm39) I205T probably damaging Het
Tmem63a A G 1: 180,785,588 (GRCm39) K240R probably benign Het
Tns2 C T 15: 102,019,351 (GRCm39) T446M probably damaging Het
Tnxb A T 17: 34,937,444 (GRCm39) N2931I probably damaging Het
Trrap G T 5: 144,776,284 (GRCm39) R2941L probably damaging Het
Ttc8 A T 12: 98,910,131 (GRCm39) R179S probably damaging Het
Ttll12 G T 15: 83,471,176 (GRCm39) T234N probably damaging Het
Ttn G T 2: 76,577,576 (GRCm39) T24439K probably damaging Het
Ube2z A T 11: 95,946,736 (GRCm39) I246N possibly damaging Het
Usp15 A G 10: 123,011,786 (GRCm39) Y104H probably damaging Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp5 G A 6: 124,798,077 (GRCm39) A436V probably damaging Het
Utp20 A G 10: 88,608,354 (GRCm39) L1561S probably damaging Het
Xrn1 A G 9: 95,927,547 (GRCm39) M1444V probably benign Het
Zfp236 G T 18: 82,651,815 (GRCm39) Q885K probably damaging Het
Zfp831 C A 2: 174,487,896 (GRCm39) P857Q possibly damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26,671,433 (GRCm39) missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26,681,427 (GRCm39) splice site probably benign
IGL01633:Appl1 APN 14 26,684,795 (GRCm39) missense probably damaging 0.99
IGL01945:Appl1 APN 14 26,650,612 (GRCm39) missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26,647,909 (GRCm39) splice site probably benign
IGL02650:Appl1 APN 14 26,672,665 (GRCm39) missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26,671,418 (GRCm39) missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26,673,473 (GRCm39) missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26,650,600 (GRCm39) missense probably damaging 1.00
R0183:Appl1 UTSW 14 26,684,811 (GRCm39) missense probably damaging 1.00
R0323:Appl1 UTSW 14 26,664,695 (GRCm39) missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26,662,213 (GRCm39) missense probably benign
R1213:Appl1 UTSW 14 26,665,950 (GRCm39) missense probably benign 0.27
R1277:Appl1 UTSW 14 26,649,813 (GRCm39) missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26,645,811 (GRCm39) missense probably damaging 1.00
R1856:Appl1 UTSW 14 26,649,706 (GRCm39) missense probably damaging 1.00
R1889:Appl1 UTSW 14 26,647,470 (GRCm39) splice site probably benign
R2145:Appl1 UTSW 14 26,671,576 (GRCm39) missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3722:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3917:Appl1 UTSW 14 26,650,561 (GRCm39) missense probably damaging 1.00
R4700:Appl1 UTSW 14 26,647,928 (GRCm39) missense probably benign 0.00
R5139:Appl1 UTSW 14 26,669,112 (GRCm39) missense probably benign 0.04
R5485:Appl1 UTSW 14 26,684,823 (GRCm39) missense probably damaging 1.00
R5536:Appl1 UTSW 14 26,645,737 (GRCm39) nonsense probably null
R5795:Appl1 UTSW 14 26,664,773 (GRCm39) missense probably benign 0.01
R7044:Appl1 UTSW 14 26,650,634 (GRCm39) missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26,685,617 (GRCm39) missense probably benign 0.01
R7943:Appl1 UTSW 14 26,667,525 (GRCm39) missense probably benign 0.01
R8110:Appl1 UTSW 14 26,649,751 (GRCm39) nonsense probably null
R8129:Appl1 UTSW 14 26,671,466 (GRCm39) missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26,650,592 (GRCm39) missense probably benign 0.35
R8211:Appl1 UTSW 14 26,667,555 (GRCm39) missense probably benign 0.18
R8239:Appl1 UTSW 14 26,686,914 (GRCm39) missense probably damaging 0.99
R8379:Appl1 UTSW 14 26,647,372 (GRCm39) critical splice donor site probably null
R8464:Appl1 UTSW 14 26,674,985 (GRCm39) nonsense probably null
R8699:Appl1 UTSW 14 26,662,212 (GRCm39) missense probably benign
R9023:Appl1 UTSW 14 26,685,652 (GRCm39) missense possibly damaging 0.93
R9090:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9203:Appl1 UTSW 14 26,682,970 (GRCm39) nonsense probably null
R9227:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9230:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9243:Appl1 UTSW 14 26,649,710 (GRCm39) missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9378:Appl1 UTSW 14 26,649,784 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGCGCTGGTTTCAAGAC -3'
(R):5'- GGAGACTGAATGCATACTCTTTTC -3'

Sequencing Primer
(F):5'- TGGTTTCAAGACCTGGCAC -3'
(R):5'- CTGAATGCATACTCTTTTCACAGAG -3'
Posted On 2019-10-07