Incidental Mutation 'R7447:Arhgap39'
ID577395
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene NameRho GTPase activating protein 39
SynonymsD15Wsu169e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R7447 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76723985-76818170 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 76765597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821] [ENSMUST00000175843] [ENSMUST00000176219] [ENSMUST00000176736] [ENSMUST00000176855] [ENSMUST00000177026]
Predicted Effect probably benign
Transcript: ENSMUST00000036176
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077821
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175843
Predicted Effect probably benign
Transcript: ENSMUST00000176219
Predicted Effect probably benign
Transcript: ENSMUST00000176736
Predicted Effect probably benign
Transcript: ENSMUST00000176855
SMART Domains Protein: ENSMUSP00000135043
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177026
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,824,122 D445G probably benign Het
Adck5 A T 15: 76,595,196 I484F possibly damaging Het
Ago2 A T 15: 73,138,032 N100K probably benign Het
Appl1 T A 14: 26,959,452 K130* probably null Het
Axdnd1 A G 1: 156,418,232 probably null Het
C77080 C A 4: 129,222,042 R988L possibly damaging Het
Camta1 A T 4: 151,083,870 V1332E probably benign Het
Cd3g A G 9: 44,973,559 L129P probably damaging Het
Cd80 T G 16: 38,473,889 S45A probably benign Het
Cdk12 A T 11: 98,245,280 Q1120L unknown Het
Clip1 G A 5: 123,653,633 S158F probably benign Het
Cntn3 C A 6: 102,278,455 E161* probably null Het
Cyp3a59 A C 5: 146,087,405 K67T probably benign Het
Dmxl1 T C 18: 49,864,614 L623P probably damaging Het
Drd3 T A 16: 43,817,063 Y208* probably null Het
Dusp10 A T 1: 184,068,956 M307L probably benign Het
Dync2li1 A T 17: 84,647,713 I267L possibly damaging Het
Edn3 C A 2: 174,761,751 C97* probably null Het
Ehbp1l1 T A 19: 5,719,428 T616S possibly damaging Het
Eif2a C T 3: 58,545,542 T246I probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Errfi1 A G 4: 150,866,651 T179A probably damaging Het
Esyt3 G A 9: 99,321,562 L450F probably damaging Het
Evx2 A G 2: 74,659,104 S106P probably benign Het
Fam83a T G 15: 58,009,690 V305G probably benign Het
Gpr171 T A 3: 59,098,439 probably null Het
Grip1 A G 10: 120,086,966 T1106A probably benign Het
Hecw1 A G 13: 14,357,204 Y162H probably damaging Het
Hephl1 C T 9: 15,097,882 probably null Het
Hsp90aa1 A G 12: 110,692,128 I693T possibly damaging Het
Ifit1bl2 T A 19: 34,619,574 D214V probably damaging Het
Igsf10 T C 3: 59,331,801 M320V probably benign Het
Kcnq2 A G 2: 181,113,094 L220P probably damaging Het
Kpna1 C A 16: 36,029,639 Q372K probably damaging Het
Lilrb4a T G 10: 51,491,053 probably null Het
Ly75 C A 2: 60,334,474 E787* probably null Het
Magi1 T G 6: 93,745,581 S666R possibly damaging Het
Mif C A 10: 75,859,853 A39S possibly damaging Het
Mob4 G A 1: 55,131,466 probably benign Het
Mtmr4 G T 11: 87,611,901 C927F probably damaging Het
Myh1 A G 11: 67,219,180 K1398R probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l G A 15: 99,427,476 P382L probably damaging Het
Ngly1 T C 14: 16,290,844 I442T probably damaging Het
Nlrp1a T C 11: 71,092,411 Y1243C probably damaging Het
Olfr1055 T A 2: 86,346,806 H320L possibly damaging Het
Pcsk5 C T 19: 17,510,236 G1027D probably benign Het
Pla2g2c T A 4: 138,731,616 I11N probably benign Het
Polr3d A G 14: 70,439,800 I331T probably damaging Het
Ppp4r4 A G 12: 103,585,726 I293M possibly damaging Het
Prkce G T 17: 86,559,259 V516F probably damaging Het
Prss27 T A 17: 24,045,709 L282Q probably damaging Het
Pxdn A G 12: 29,984,927 Y261C probably damaging Het
R3hcc1l T C 19: 42,562,662 S33P probably benign Het
Rab11fip3 G C 17: 26,068,874 R102G possibly damaging Het
Rabggta A T 14: 55,719,316 N310K probably null Het
Rbbp8 T A 18: 11,660,877 D15E probably benign Het
Rbm5 T C 9: 107,746,179 Y486C probably damaging Het
Rptor T A 11: 119,884,979 F992Y probably benign Het
Slc29a2 T G 19: 5,026,417 L111R probably damaging Het
Slc39a11 T A 11: 113,562,023 I31L probably benign Het
Slc6a20a T A 9: 123,656,224 N311I possibly damaging Het
Slc8a1 A G 17: 81,649,006 F201S probably damaging Het
Smtn C A 11: 3,530,196 V342L probably benign Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tchp A G 5: 114,715,655 T267A probably benign Het
Tctex1d2 T A 16: 32,425,271 V95E probably damaging Het
Tes3-ps A G 13: 49,494,032 E128G possibly damaging Het
Tigar C T 6: 127,088,166 G173E probably benign Het
Tmem171 T C 13: 98,688,354 N256S probably benign Het
Tmem204 A G 17: 25,058,296 I205T probably damaging Het
Tmem63a A G 1: 180,958,023 K240R probably benign Het
Tns2 C T 15: 102,110,916 T446M probably damaging Het
Tnxb A T 17: 34,718,470 N2931I probably damaging Het
Trrap G T 5: 144,839,474 R2941L probably damaging Het
Ttc8 A T 12: 98,943,872 R179S probably damaging Het
Ttll12 G T 15: 83,586,975 T234N probably damaging Het
Ttn G T 2: 76,747,232 T24439K probably damaging Het
Ube2z A T 11: 96,055,910 I246N possibly damaging Het
Usp15 A G 10: 123,175,881 Y104H probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp5 G A 6: 124,821,114 A436V probably damaging Het
Utp20 A G 10: 88,772,492 L1561S probably damaging Het
Xrn1 A G 9: 96,045,494 M1444V probably benign Het
Zfp236 G T 18: 82,633,690 Q885K probably damaging Het
Zfp831 C A 2: 174,646,103 P857Q possibly damaging Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76737815 splice site probably benign
IGL01586:Arhgap39 APN 15 76730438 missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76725967 missense probably null 1.00
IGL02017:Arhgap39 APN 15 76737037 missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76724984 makesense probably null
IGL03333:Arhgap39 APN 15 76726732 missense probably benign 0.05
R0328:Arhgap39 UTSW 15 76751952 splice site probably benign
R0432:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76751559 missense probably benign
R1830:Arhgap39 UTSW 15 76735183 missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76725146 missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76725385 missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76751888 missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76725512 unclassified probably benign
R4626:Arhgap39 UTSW 15 76737637 missense possibly damaging 0.92
R4790:Arhgap39 UTSW 15 76726731 missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76741517 missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76737805 missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76725515 unclassified probably benign
R5417:Arhgap39 UTSW 15 76735101 missense possibly damaging 0.80
R5443:Arhgap39 UTSW 15 76797925 intron probably benign
R5521:Arhgap39 UTSW 15 76765494 missense possibly damaging 0.66
R5686:Arhgap39 UTSW 15 76726633 missense probably damaging 1.00
R5747:Arhgap39 UTSW 15 76741535 missense possibly damaging 0.68
R5785:Arhgap39 UTSW 15 76737418 missense probably benign
R5879:Arhgap39 UTSW 15 76751807 missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6049:Arhgap39 UTSW 15 76727401 critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76730406 nonsense probably null
R6232:Arhgap39 UTSW 15 76736512 missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76737536 missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76735137 missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76737702 missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76737499 missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76765491 missense probably benign 0.09
R7658:Arhgap39 UTSW 15 76737417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACCTTTTCTCTGAACAGTTGC -3'
(R):5'- TCTGTACAAGAGAAGCTGGCC -3'

Sequencing Primer
(F):5'- TGAACAGTTGCTCCCCCAC -3'
(R):5'- TGGCTTCCCCAAGGAGTCTTG -3'
Posted On2019-10-07