Mutagenetix > Incidental Mutations

Incidental Mutation 'R7447:Tnxb'

577406

Institutional Source

Beutler Lab

Gene Symbol

Tnxb

Ensembl Gene

ENSMUSG00000033327

Gene Name

tenascin XB

Synonyms

Tnx, TN-MHC

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34670535-34719815 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34718470 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 2931 (N2931I)

Ref Sequence

ENSEMBL: ENSMUSP00000127487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087399
AA Change: N3811I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: N3811I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	1047	1126	3.97e-5	SMART
FN3	1142	1223	3.62e-8	SMART
low complexity region	1230	1241	N/A	INTRINSIC
FN3	1242	1320	2.31e-6	SMART
FN3	1351	1431	8.77e-7	SMART
FN3	1460	1539	3.01e-5	SMART
FN3	1556	1636	2.76e-4	SMART
FN3	1657	1736	5.78e-7	SMART
FN3	1752	1832	4.7e-7	SMART
FN3	1851	1929	1.95e-4	SMART
FN3	1955	2034	4.56e-5	SMART
FN3	2066	2145	2.23e-8	SMART
FN3	2164	2244	7.75e-8	SMART
FN3	2279	2358	8.5e-5	SMART
FN3	2387	2467	2.94e-8	SMART
FN3	2501	2580	1.7e-4	SMART
low complexity region	2588	2598	N/A	INTRINSIC
FN3	2607	2687	6.75e-8	SMART
FN3	2716	2795	7.4e-5	SMART
FN3	2822	2902	1.35e-7	SMART
FN3	2931	3010	5.61e-5	SMART
FN3	3026	3106	6.01e-5	SMART
FN3	3120	3199	6.45e-5	SMART
FN3	3214	3293	9.54e-8	SMART
FN3	3316	3396	2.81e-5	SMART
FN3	3416	3502	1.98e-5	SMART
FN3	3518	3596	5.65e-10	SMART
FN3	3607	3682	7.63e-7	SMART
FN3	3695	3770	6.54e-6	SMART
FBG	3787	3997	8.88e-125	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168533
AA Change: N2931I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327
AA Change: N2931I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
low complexity region	92	103	N/A	INTRINSIC
EGF	173	201	1.59e1	SMART
EGF	204	232	7.41e0	SMART
EGF	235	263	2.64e1	SMART
EGF	266	294	2.64e1	SMART
EGF	297	325	9.13e0	SMART
EGF	328	356	2.07e1	SMART
EGF_like	359	387	3.16e1	SMART
EGF_like	390	418	4.64e1	SMART
EGF_like	421	449	3.29e1	SMART
EGF_like	452	480	7.09e1	SMART
EGF	483	511	1.15e1	SMART
EGF	514	542	1.91e1	SMART
EGF_like	545	573	4.11e1	SMART
EGF	576	604	7.95e0	SMART
EGF	607	635	1.23e1	SMART
EGF_like	638	666	4.93e1	SMART
EGF_like	674	702	5.24e1	SMART
EGF	705	733	2.29e1	SMART
FN3	736	816	4.12e-3	SMART
FN3	827	904	1.21e-9	SMART
FN3	924	1003	3.97e-5	SMART
FN3	1019	1100	3.62e-8	SMART
low complexity region	1107	1118	N/A	INTRINSIC
FN3	1119	1197	2.31e-6	SMART
FN3	1228	1308	8.77e-7	SMART
FN3	1337	1416	3.01e-5	SMART
FN3	1433	1513	2.76e-4	SMART
FN3	1534	1613	5.78e-7	SMART
FN3	1629	1709	4.7e-7	SMART
FN3	1728	1806	1.95e-4	SMART
FN3	1832	1911	4.56e-5	SMART
FN3	1943	2022	2.23e-8	SMART
FN3	2051	2130	5.61e-5	SMART
FN3	2146	2226	6.01e-5	SMART
FN3	2240	2319	6.45e-5	SMART
FN3	2334	2413	9.54e-8	SMART
FN3	2436	2516	2.81e-5	SMART
FN3	2536	2622	1.98e-5	SMART
FN3	2638	2716	5.65e-10	SMART
FN3	2727	2802	7.63e-7	SMART
FN3	2815	2890	6.54e-6	SMART
FBG	2907	3117	8.88e-125	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	T	C	11: 29,824,122	D445G	probably benign	Het
Adck5	A	T	15: 76,595,196	I484F	possibly damaging	Het
Ago2	A	T	15: 73,138,032	N100K	probably benign	Het
Appl1	T	A	14: 26,959,452	K130*	probably null	Het
Arhgap39	G	A	15: 76,765,597		probably benign	Het
Axdnd1	A	G	1: 156,418,232		probably null	Het
C77080	C	A	4: 129,222,042	R988L	possibly damaging	Het
Camta1	A	T	4: 151,083,870	V1332E	probably benign	Het
Cd3g	A	G	9: 44,973,559	L129P	probably damaging	Het
Cd80	T	G	16: 38,473,889	S45A	probably benign	Het
Cdk12	A	T	11: 98,245,280	Q1120L	unknown	Het
Clip1	G	A	5: 123,653,633	S158F	probably benign	Het
Cntn3	C	A	6: 102,278,455	E161*	probably null	Het
Cyp3a59	A	C	5: 146,087,405	K67T	probably benign	Het
Dmxl1	T	C	18: 49,864,614	L623P	probably damaging	Het
Drd3	T	A	16: 43,817,063	Y208*	probably null	Het
Dusp10	A	T	1: 184,068,956	M307L	probably benign	Het
Dync2li1	A	T	17: 84,647,713	I267L	possibly damaging	Het
Edn3	C	A	2: 174,761,751	C97*	probably null	Het
Ehbp1l1	T	A	19: 5,719,428	T616S	possibly damaging	Het
Eif2a	C	T	3: 58,545,542	T246I	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Errfi1	A	G	4: 150,866,651	T179A	probably damaging	Het
Esyt3	G	A	9: 99,321,562	L450F	probably damaging	Het
Evx2	A	G	2: 74,659,104	S106P	probably benign	Het
Fam83a	T	G	15: 58,009,690	V305G	probably benign	Het
Gpr171	T	A	3: 59,098,439		probably null	Het
Grip1	A	G	10: 120,086,966	T1106A	probably benign	Het
Hecw1	A	G	13: 14,357,204	Y162H	probably damaging	Het
Hephl1	C	T	9: 15,097,882		probably null	Het
Hsp90aa1	A	G	12: 110,692,128	I693T	possibly damaging	Het
Ifit1bl2	T	A	19: 34,619,574	D214V	probably damaging	Het
Igsf10	T	C	3: 59,331,801	M320V	probably benign	Het
Kcnq2	A	G	2: 181,113,094	L220P	probably damaging	Het
Kpna1	C	A	16: 36,029,639	Q372K	probably damaging	Het
Lilrb4a	T	G	10: 51,491,053		probably null	Het
Ly75	C	A	2: 60,334,474	E787*	probably null	Het
Magi1	T	G	6: 93,745,581	S666R	possibly damaging	Het
Mif	C	A	10: 75,859,853	A39S	possibly damaging	Het
Mob4	G	A	1: 55,131,466		probably benign	Het
Mtmr4	G	T	11: 87,611,901	C927F	probably damaging	Het
Myh1	A	G	11: 67,219,180	K1398R	probably benign	Het
Myo3a	T	C	2: 22,544,426	V873A	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	G	A	15: 99,427,476	P382L	probably damaging	Het
Ngly1	T	C	14: 16,290,844	I442T	probably damaging	Het
Nlrp1a	T	C	11: 71,092,411	Y1243C	probably damaging	Het
Olfr1055	T	A	2: 86,346,806	H320L	possibly damaging	Het
Pcsk5	C	T	19: 17,510,236	G1027D	probably benign	Het
Pla2g2c	T	A	4: 138,731,616	I11N	probably benign	Het
Polr3d	A	G	14: 70,439,800	I331T	probably damaging	Het
Ppp4r4	A	G	12: 103,585,726	I293M	possibly damaging	Het
Prkce	G	T	17: 86,559,259	V516F	probably damaging	Het
Prss27	T	A	17: 24,045,709	L282Q	probably damaging	Het
Pxdn	A	G	12: 29,984,927	Y261C	probably damaging	Het
R3hcc1l	T	C	19: 42,562,662	S33P	probably benign	Het
Rab11fip3	G	C	17: 26,068,874	R102G	possibly damaging	Het
Rabggta	A	T	14: 55,719,316	N310K	probably null	Het
Rbbp8	T	A	18: 11,660,877	D15E	probably benign	Het
Rbm5	T	C	9: 107,746,179	Y486C	probably damaging	Het
Rptor	T	A	11: 119,884,979	F992Y	probably benign	Het
Slc29a2	T	G	19: 5,026,417	L111R	probably damaging	Het
Slc39a11	T	A	11: 113,562,023	I31L	probably benign	Het
Slc6a20a	T	A	9: 123,656,224	N311I	possibly damaging	Het
Slc8a1	A	G	17: 81,649,006	F201S	probably damaging	Het
Smtn	C	A	11: 3,530,196	V342L	probably benign	Het
Syne2	A	G	12: 76,028,079	T4598A	probably benign	Het
Tchp	A	G	5: 114,715,655	T267A	probably benign	Het
Tctex1d2	T	A	16: 32,425,271	V95E	probably damaging	Het
Tes3-ps	A	G	13: 49,494,032	E128G	possibly damaging	Het
Tigar	C	T	6: 127,088,166	G173E	probably benign	Het
Tmem171	T	C	13: 98,688,354	N256S	probably benign	Het
Tmem204	A	G	17: 25,058,296	I205T	probably damaging	Het
Tmem63a	A	G	1: 180,958,023	K240R	probably benign	Het
Tns2	C	T	15: 102,110,916	T446M	probably damaging	Het
Trrap	G	T	5: 144,839,474	R2941L	probably damaging	Het
Ttc8	A	T	12: 98,943,872	R179S	probably damaging	Het
Ttll12	G	T	15: 83,586,975	T234N	probably damaging	Het
Ttn	G	T	2: 76,747,232	T24439K	probably damaging	Het
Ube2z	A	T	11: 96,055,910	I246N	possibly damaging	Het
Usp15	A	G	10: 123,175,881	Y104H	probably damaging	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp5	G	A	6: 124,821,114	A436V	probably damaging	Het
Utp20	A	G	10: 88,772,492	L1561S	probably damaging	Het
Xrn1	A	G	9: 96,045,494	M1444V	probably benign	Het
Zfp236	G	T	18: 82,633,690	Q885K	probably damaging	Het
Zfp831	C	A	2: 174,646,103	P857Q	possibly damaging	Het

Other mutations in Tnxb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Tnxb	APN	17	34685629	missense	probably damaging	1.00
IGL00424:Tnxb	APN	17	34714692	missense	probably damaging	1.00
IGL00486:Tnxb	APN	17	34692382	missense	probably damaging	1.00
IGL00952:Tnxb	APN	17	34713128	missense	probably damaging	1.00
IGL00974:Tnxb	APN	17	34718733	critical splice donor site	probably null
IGL01017:Tnxb	APN	17	34693808	missense	probably damaging	0.98
IGL01082:Tnxb	APN	17	34714610	missense	probably damaging	0.97
IGL01397:Tnxb	APN	17	34714673	missense	probably damaging	0.99
IGL01473:Tnxb	APN	17	34685701	missense	probably damaging	0.99
IGL01642:Tnxb	APN	17	34718514	missense	probably damaging	1.00
IGL01774:Tnxb	APN	17	34688839	missense	probably damaging	1.00
IGL01971:Tnxb	APN	17	34672297	missense	probably damaging	1.00
IGL02016:Tnxb	APN	17	34672275	missense	probably damaging	0.98
IGL02160:Tnxb	APN	17	34714745	missense	probably benign	0.01
IGL02473:Tnxb	APN	17	34717762	missense	probably damaging	1.00
IGL02666:Tnxb	APN	17	34684939	missense	probably benign	0.20
IGL02831:Tnxb	APN	17	34703571	missense	possibly damaging	0.93
IGL02838:Tnxb	APN	17	34689632	missense	possibly damaging	0.74
IGL02965:Tnxb	APN	17	34709654	missense	possibly damaging	0.93
IGL03155:Tnxb	APN	17	34713595	missense	probably damaging	1.00
IGL03194:Tnxb	APN	17	34695947	nonsense	probably null
IGL03215:Tnxb	APN	17	34692525	missense	possibly damaging	0.66
IGL03256:Tnxb	APN	17	34688720	missense	probably damaging	1.00
E0370:Tnxb	UTSW	17	34678943	missense	probably damaging	1.00
R0006:Tnxb	UTSW	17	34682292	missense	probably benign	0.07
R0049:Tnxb	UTSW	17	34709568	missense	possibly damaging	0.93
R0050:Tnxb	UTSW	17	34673325	missense	probably damaging	1.00
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0233:Tnxb	UTSW	17	34699033	missense	probably benign	0.32
R0311:Tnxb	UTSW	17	34716984	missense	probably damaging	0.97
R0326:Tnxb	UTSW	17	34698179	missense	probably benign	0.32
R0387:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R0396:Tnxb	UTSW	17	34671733	missense	probably damaging	1.00
R0511:Tnxb	UTSW	17	34718245	missense	probably damaging	0.96
R0540:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0563:Tnxb	UTSW	17	34716947	missense	probably benign	0.05
R0575:Tnxb	UTSW	17	34717206	missense	possibly damaging	0.91
R0586:Tnxb	UTSW	17	34672144	missense	probably damaging	1.00
R0607:Tnxb	UTSW	17	34671918	missense	probably damaging	1.00
R0622:Tnxb	UTSW	17	34718729	missense	probably damaging	1.00
R0624:Tnxb	UTSW	17	34683548	missense	probably damaging	1.00
R0709:Tnxb	UTSW	17	34689354	missense	probably damaging	1.00
R0898:Tnxb	UTSW	17	34670745	missense	probably damaging	1.00
R0970:Tnxb	UTSW	17	34698943	missense	possibly damaging	0.85
R0972:Tnxb	UTSW	17	34685143	missense	probably damaging	1.00
R1118:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1119:Tnxb	UTSW	17	34685043	missense	probably damaging	1.00
R1226:Tnxb	UTSW	17	34688929	missense	probably damaging	1.00
R1296:Tnxb	UTSW	17	34671577	missense	probably damaging	1.00
R1297:Tnxb	UTSW	17	34710166	missense	probably damaging	0.96
R1349:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1356:Tnxb	UTSW	17	34695472	missense	possibly damaging	0.53
R1372:Tnxb	UTSW	17	34710293	missense	possibly damaging	0.67
R1521:Tnxb	UTSW	17	34711503	missense	probably damaging	1.00
R1522:Tnxb	UTSW	17	34718638	missense	probably damaging	1.00
R1532:Tnxb	UTSW	17	34710830	missense	probably damaging	1.00
R1735:Tnxb	UTSW	17	34717970	missense	probably damaging	1.00
R1778:Tnxb	UTSW	17	34683574	missense	probably benign	0.30
R1802:Tnxb	UTSW	17	34703889	missense	probably damaging	0.98
R1824:Tnxb	UTSW	17	34692333	nonsense	probably null
R1838:Tnxb	UTSW	17	34678910	missense	probably damaging	0.96
R1863:Tnxb	UTSW	17	34670874	missense	probably damaging	1.00
R1865:Tnxb	UTSW	17	34703457	nonsense	probably null
R1867:Tnxb	UTSW	17	34671847	missense	probably damaging	1.00
R1883:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1884:Tnxb	UTSW	17	34689565	missense	probably benign	0.01
R1889:Tnxb	UTSW	17	34695825	missense	probably damaging	0.97
R1969:Tnxb	UTSW	17	34679081	missense	probably benign	0.20
R1989:Tnxb	UTSW	17	34683377	missense	probably benign	0.08
R1989:Tnxb	UTSW	17	34693885	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R1991:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R1992:Tnxb	UTSW	17	34671904	missense	probably damaging	1.00
R2001:Tnxb	UTSW	17	34692579	missense	possibly damaging	0.82
R2018:Tnxb	UTSW	17	34671750	missense	probably benign	0.04
R2030:Tnxb	UTSW	17	34718469	missense	probably damaging	1.00
R2037:Tnxb	UTSW	17	34699205	missense	probably damaging	1.00
R2103:Tnxb	UTSW	17	34682251	missense	probably damaging	1.00
R2116:Tnxb	UTSW	17	34672227	missense	probably damaging	1.00
R2206:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2207:Tnxb	UTSW	17	34709417	missense	possibly damaging	0.86
R2215:Tnxb	UTSW	17	34704140	missense	possibly damaging	0.93
R2413:Tnxb	UTSW	17	34718278	missense	probably damaging	0.99
R2680:Tnxb	UTSW	17	34703620	missense	possibly damaging	0.51
R2910:Tnxb	UTSW	17	34672450	missense	probably damaging	1.00
R2984:Tnxb	UTSW	17	34678662	nonsense	probably null
R3120:Tnxb	UTSW	17	34692355	missense	possibly damaging	0.86
R3429:Tnxb	UTSW	17	34672631	nonsense	probably null
R3429:Tnxb	UTSW	17	34703587	missense	probably damaging	0.98
R3552:Tnxb	UTSW	17	34718721	missense	probably damaging	1.00
R3698:Tnxb	UTSW	17	34690433	critical splice donor site	probably null
R3720:Tnxb	UTSW	17	34712964	missense	possibly damaging	0.95
R3841:Tnxb	UTSW	17	34698923	missense	possibly damaging	0.72
R3848:Tnxb	UTSW	17	34690395	missense	possibly damaging	0.82
R3886:Tnxb	UTSW	17	34718911	missense	probably damaging	1.00
R4074:Tnxb	UTSW	17	34671871	missense	probably benign	0.22
R4159:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4160:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4161:Tnxb	UTSW	17	34711517	missense	probably damaging	0.99
R4181:Tnxb	UTSW	17	34709454	missense	possibly damaging	0.93
R4210:Tnxb	UTSW	17	34710977	missense	possibly damaging	0.84
R4275:Tnxb	UTSW	17	34698231	missense	probably damaging	0.98
R4329:Tnxb	UTSW	17	34693864	missense	probably damaging	1.00
R4394:Tnxb	UTSW	17	34678662	nonsense	probably null
R4395:Tnxb	UTSW	17	34678662	nonsense	probably null
R4397:Tnxb	UTSW	17	34678662	nonsense	probably null
R4540:Tnxb	UTSW	17	34703335	missense	possibly damaging	0.86
R4673:Tnxb	UTSW	17	34672540	missense	probably damaging	0.99
R4719:Tnxb	UTSW	17	34689420	missense	probably damaging	1.00
R4725:Tnxb	UTSW	17	34699067	missense	probably damaging	0.99
R4753:Tnxb	UTSW	17	34695935	missense	possibly damaging	0.71
R4777:Tnxb	UTSW	17	34671943	missense	probably damaging	1.00
R4837:Tnxb	UTSW	17	34718007	missense	probably damaging	0.98
R4898:Tnxb	UTSW	17	34695592	missense	possibly damaging	0.95
R4938:Tnxb	UTSW	17	34713632	missense	probably damaging	1.00
R5044:Tnxb	UTSW	17	34717483	missense	probably damaging	1.00
R5100:Tnxb	UTSW	17	34710928	missense	probably damaging	0.99
R5223:Tnxb	UTSW	17	34704078	missense	possibly damaging	0.51
R5269:Tnxb	UTSW	17	34703608	missense	possibly damaging	0.95
R5333:Tnxb	UTSW	17	34690231	missense	probably damaging	1.00
R5454:Tnxb	UTSW	17	34709625	missense	possibly damaging	0.71
R5470:Tnxb	UTSW	17	34716973	missense	probably null	1.00
R5475:Tnxb	UTSW	17	34689593	missense	probably damaging	1.00
R5574:Tnxb	UTSW	17	34711024	missense	probably benign
R5596:Tnxb	UTSW	17	34688804	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690202	missense	probably damaging	1.00
R5599:Tnxb	UTSW	17	34690205	missense	probably benign	0.22
R5615:Tnxb	UTSW	17	34683418	missense	probably damaging	1.00
R5620:Tnxb	UTSW	17	34717530	nonsense	probably null
R5625:Tnxb	UTSW	17	34685211	missense	probably benign	0.30
R5734:Tnxb	UTSW	17	34698910	missense	possibly damaging	0.53
R5896:Tnxb	UTSW	17	34672152	missense	probably damaging	1.00
R5961:Tnxb	UTSW	17	34718635	missense	probably damaging	1.00
R5974:Tnxb	UTSW	17	34685707	missense	probably damaging	1.00
R6091:Tnxb	UTSW	17	34710364	missense	probably damaging	0.98
R6134:Tnxb	UTSW	17	34672012	missense	probably damaging	0.96
R6325:Tnxb	UTSW	17	34692424	missense	probably damaging	1.00
R6358:Tnxb	UTSW	17	34678994	missense	probably damaging	0.98
R6362:Tnxb	UTSW	17	34694388	missense	probably damaging	1.00
R6432:Tnxb	UTSW	17	34717917	missense	probably damaging	1.00
R6461:Tnxb	UTSW	17	34671898	missense	probably damaging	1.00
R6467:Tnxb	UTSW	17	34693924	missense	probably damaging	1.00
R6476:Tnxb	UTSW	17	34690192	missense	probably damaging	0.98
R6477:Tnxb	UTSW	17	34719539	missense	probably damaging	1.00
R6631:Tnxb	UTSW	17	34718248	missense	probably damaging	1.00
R6774:Tnxb	UTSW	17	34709632	nonsense	probably null
R6787:Tnxb	UTSW	17	34710736	missense	probably benign	0.02
R6805:Tnxb	UTSW	17	34698153	missense	possibly damaging	0.93
R6860:Tnxb	UTSW	17	34713157	missense	probably damaging	0.99
R6883:Tnxb	UTSW	17	34718519	missense	probably damaging	1.00
R7049:Tnxb	UTSW	17	34717268	critical splice donor site	probably null
R7107:Tnxb	UTSW	17	34671340	missense	unknown
R7172:Tnxb	UTSW	17	34696020	missense	probably damaging	1.00
R7206:Tnxb	UTSW	17	34704101	missense	possibly damaging	0.71
R7219:Tnxb	UTSW	17	34679065	missense	probably benign	0.08
R7237:Tnxb	UTSW	17	34682196	missense	possibly damaging	0.82
R7257:Tnxb	UTSW	17	34716501	missense	probably benign	0.44
R7269:Tnxb	UTSW	17	34695454	missense	probably damaging	1.00
R7302:Tnxb	UTSW	17	34678901	missense	probably benign	0.41
R7372:Tnxb	UTSW	17	34717254	missense	possibly damaging	0.72
R7384:Tnxb	UTSW	17	34718518	missense	probably damaging	1.00
R7449:Tnxb	UTSW	17	34703361	missense	possibly damaging	0.93
R7480:Tnxb	UTSW	17	34715773	missense	probably damaging	0.96
R7506:Tnxb	UTSW	17	34715691	missense	possibly damaging	0.89
R7586:Tnxb	UTSW	17	34716408	missense	probably damaging	0.98
R7688:Tnxb	UTSW	17	34671906	missense	probably benign	0.23
R7690:Tnxb	UTSW	17	34689520	missense	probably benign	0.03
R7690:Tnxb	UTSW	17	34689527	missense	probably damaging	1.00
R7732:Tnxb	UTSW	17	34694280	missense	probably damaging	1.00
R7735:Tnxb	UTSW	17	34671424	missense	unknown
R7760:Tnxb	UTSW	17	34712937	missense	probably damaging	0.96
R7874:Tnxb	UTSW	17	34711443	missense	probably damaging	1.00
R7909:Tnxb	UTSW	17	34692454	missense	probably benign	0.02
R7957:Tnxb	UTSW	17	34711443	missense	probably damaging	1.00
R7990:Tnxb	UTSW	17	34692454	missense	probably benign	0.02
R8040:Tnxb	UTSW	17	34716558	missense	probably damaging	1.00
R8053:Tnxb	UTSW	17	34704179	missense	probably damaging	0.98
R8074:Tnxb	UTSW	17	34703981	missense	probably benign	0.32
X0004:Tnxb	UTSW	17	34703415	missense	possibly damaging	0.71
X0010:Tnxb	UTSW	17	34671934	missense	probably damaging	1.00
X0019:Tnxb	UTSW	17	34694189	missense	possibly damaging	0.51
X0063:Tnxb	UTSW	17	34703508	missense	probably damaging	0.98
X0064:Tnxb	UTSW	17	34694032	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34671766	missense	unknown
Z1177:Tnxb	UTSW	17	34683331	missense	probably damaging	1.00
Z1177:Tnxb	UTSW	17	34718726	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TACTACTGGTACTGGCTCTGG -3'
(R):5'- TCTCCAGAAGTCCGTCTGTC -3'

Sequencing Primer
(F):5'- CTCTGGGGTTTGAGCTTCGC -3'
(R):5'- AGAAGTCCGTCTGTCCATCCATG -3'

Posted On

2019-10-07