Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Lrit3'

57741

Institutional Source

Beutler Lab

Gene Symbol

Lrit3

Ensembl Gene

ENSMUSG00000093865

Gene Name

leucine-rich repeat, immunoglobulin-like and transmembrane domains 3

Synonyms

LOC242235

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0629 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

129787881-129804030 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129788302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 679 (Y679H)

Ref Sequence

ENSEMBL: ENSMUSP00000140184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]

AlphaFold

W8DXL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000179187
AA Change: Y558H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: Y558H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	2.7e-1	SMART
LRR	80	103	6.96e0	SMART
LRR	104	127	3.27e1	SMART
LRR_TYP	128	151	4.47e-3	SMART
LRR_TYP	152	175	7.37e-4	SMART
LRRCT	201	252	4.65e-2	SMART
Blast:IG	260	297	9e-13	BLAST
low complexity region	298	311	N/A	INTRINSIC
FN3	364	443	1.85e0	SMART
transmembrane domain	462	484	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185462
AA Change: Y679H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: Y679H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	1.3e-3	SMART
LRR	80	103	2.9e-2	SMART
LRR	104	127	1.4e-1	SMART
LRR_TYP	128	151	1.9e-5	SMART
LRR_TYP	152	175	3.2e-6	SMART
LRRCT	201	252	2.3e-4	SMART
IGc2	266	335	4.7e-11	SMART
low complexity region	340	352	N/A	INTRINSIC
low complexity region	362	376	N/A	INTRINSIC
low complexity region	408	432	N/A	INTRINSIC
FN3	485	564	9e-3	SMART
transmembrane domain	583	605	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188978

Meta Mutation Damage Score

0.2439

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Lrit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4304:Lrit3	UTSW	3	129788819	small insertion	probably benign
FR4340:Lrit3	UTSW	3	129788808	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788813	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788816	small insertion	probably benign
FR4589:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4737:Lrit3	UTSW	3	129788806	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129788810	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4976:Lrit3	UTSW	3	129803910	unclassified	probably benign
R0555:Lrit3	UTSW	3	129791296	missense	probably damaging	1.00
R0631:Lrit3	UTSW	3	129788555	missense	probably damaging	1.00
R1690:Lrit3	UTSW	3	129800745	missense	probably damaging	0.99
R1902:Lrit3	UTSW	3	129791246	missense	probably benign	0.17
R1955:Lrit3	UTSW	3	129800481	missense	probably benign	0.11
R3155:Lrit3	UTSW	3	129791395	missense	probably benign	0.00
R4005:Lrit3	UTSW	3	129791372	missense	probably benign	0.14
R4445:Lrit3	UTSW	3	129788531	nonsense	probably null
R4675:Lrit3	UTSW	3	129788472	missense	probably damaging	1.00
R5104:Lrit3	UTSW	3	129788391	missense	possibly damaging	0.86
R5147:Lrit3	UTSW	3	129803925	missense	possibly damaging	0.78
R5271:Lrit3	UTSW	3	129788301	missense	probably damaging	1.00
R5505:Lrit3	UTSW	3	129791438	missense	possibly damaging	0.83
R5587:Lrit3	UTSW	3	129788898	missense	probably benign	0.25
R6056:Lrit3	UTSW	3	129789355	missense	probably damaging	1.00
R6239:Lrit3	UTSW	3	129800346	missense	probably damaging	0.98
R6280:Lrit3	UTSW	3	129788763	missense	probably damaging	0.99
R6305:Lrit3	UTSW	3	129800460	missense	probably damaging	0.98
R6441:Lrit3	UTSW	3	129800360	missense	probably benign
R6947:Lrit3	UTSW	3	129789234	missense	probably benign	0.01
R6949:Lrit3	UTSW	3	129789285	missense	probably damaging	1.00
R7850:Lrit3	UTSW	3	129800803	missense	probably damaging	1.00
R8157:Lrit3	UTSW	3	129800635	missense	probably benign	0.00
R8405:Lrit3	UTSW	3	129788652	missense	probably benign	0.26
R8896:Lrit3	UTSW	3	129791483	missense	probably damaging	1.00
R8937:Lrit3	UTSW	3	129800544	missense	probably damaging	1.00
R9794:Lrit3	UTSW	3	129800424	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCCTAAAACTGTGGCAAGCTTC -3'
(R):5'- TGCAATGCACATCGGACCCTTTC -3'

Sequencing Primer
(F):5'- TCTTTATACAGACGCCATGCAG -3'
(R):5'- TTCTGGGAAGAGGATTTGTCAAAAG -3'

Posted On

2013-07-11