Incidental Mutation 'R7448:Rb1cc1'
ID 577419
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene Name RB1-inducible coiled-coil 1
Synonyms Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7448 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 6206197-6276648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6245503 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 541 (F541I)
Ref Sequence ENSEMBL: ENSMUSP00000027040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]
AlphaFold Q9ESK9
Predicted Effect probably damaging
Transcript: ENSMUST00000027040
AA Change: F541I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: F541I

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: F420I

DomainStartEndE-ValueType
low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162257
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162795
AA Change: F524I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907
AA Change: F524I

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 2e-4 SMART
Blast:UBQ 3 76 4e-12 BLAST
low complexity region 454 469 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
coiled coil region 842 865 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Itpr2 C A 6: 146,329,508 V1215L probably damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprf T C 4: 118,235,667 D517G probably benign Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trank1 C A 9: 111,366,349 P1147Q probably benign Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Tsen34 T C 7: 3,695,835 probably null Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Wwc1 G A 11: 35,875,706 T574I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
fingerling UTSW 1 6261032 missense probably damaging 1.00
tots UTSW 1 6245637 missense probably damaging 0.99
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 splice site probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3967:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3969:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6054:Rb1cc1 UTSW 1 6249834 missense probably benign 0.01
R6064:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
R7031:Rb1cc1 UTSW 1 6238466 critical splice donor site probably null
R7066:Rb1cc1 UTSW 1 6250005 missense possibly damaging 0.69
R7185:Rb1cc1 UTSW 1 6238383 missense probably damaging 1.00
R7276:Rb1cc1 UTSW 1 6249192 missense probably benign 0.13
R7463:Rb1cc1 UTSW 1 6249180 missense probably benign
R7484:Rb1cc1 UTSW 1 6274217 missense probably damaging 1.00
R7496:Rb1cc1 UTSW 1 6248191 missense probably null 0.02
R7618:Rb1cc1 UTSW 1 6265558 splice site probably null
R7681:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R7774:Rb1cc1 UTSW 1 6248085 missense possibly damaging 0.63
R7780:Rb1cc1 UTSW 1 6248914 nonsense probably null
R7947:Rb1cc1 UTSW 1 6248562 missense probably damaging 1.00
R8057:Rb1cc1 UTSW 1 6245219 missense probably damaging 1.00
R8094:Rb1cc1 UTSW 1 6263224 nonsense probably null
R8527:Rb1cc1 UTSW 1 6244875 missense probably damaging 1.00
R8758:Rb1cc1 UTSW 1 6240227 missense probably benign 0.10
R8843:Rb1cc1 UTSW 1 6245171 missense probably damaging 1.00
R8922:Rb1cc1 UTSW 1 6248970 missense probably benign
R8937:Rb1cc1 UTSW 1 6263217 missense probably benign
R9018:Rb1cc1 UTSW 1 6249266 missense probably benign
R9106:Rb1cc1 UTSW 1 6248885 missense
R9127:Rb1cc1 UTSW 1 6262849 missense probably damaging 1.00
R9130:Rb1cc1 UTSW 1 6244885 missense probably damaging 0.99
R9311:Rb1cc1 UTSW 1 6240315 missense probably damaging 1.00
R9365:Rb1cc1 UTSW 1 6244893 missense probably damaging 1.00
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACACTACAGAGAGGTAAGCAATTC -3'
(R):5'- GTTTCTGATAAATGCTTCTAACCCTG -3'

Sequencing Primer
(F):5'- GGCTGGTGCTTTAGTCAA -3'
(R):5'- CAGGAGTCCAGTCCTTTAA -3'
Posted On 2019-10-07