Mutagenetix > Incidental Mutation

Incidental Mutation 'R7448:Casp8ap2'

577443

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7448 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32643974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1016 (S1016T)

Ref Sequence

ENSEMBL: ENSMUSP00000029950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029950
AA Change: S1016T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: S1016T

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178925
AA Change: S1016T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: S1016T

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.1252

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (117/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,257,266	N256D	probably damaging	Het
1700015F17Rik	T	C	5: 5,455,952	I110V	probably benign	Het
Acss2	T	C	2: 155,518,266	S54P	probably damaging	Het
Ahnak2	T	C	12: 112,782,502	K1242E		Het
Alpi	T	A	1: 87,101,535	M1L	possibly damaging	Het
Atp2c1	C	T	9: 105,452,783	A283T	probably damaging	Het
Atp8b5	T	G	4: 43,366,021	M764R	probably benign	Het
B4galnt2	T	A	11: 95,869,367	H278L	probably damaging	Het
Bcl9l	G	T	9: 44,509,337	A1347S	probably benign	Het
Bicd2	A	G	13: 49,379,951	E671G	probably damaging	Het
Bmp3	A	T	5: 98,872,218	I167F	probably damaging	Het
Bpifb5	T	A	2: 154,230,185	C271S	possibly damaging	Het
Camsap2	T	A	1: 136,270,906	H793L		Het
Ccdc134	T	A	15: 82,140,948	I216N	possibly damaging	Het
Ccdc63	G	T	5: 122,108,182	R559S	probably benign	Het
Cd276	T	C	9: 58,535,612	T187A	probably benign	Het
Ciao1	C	T	2: 127,245,758	R219H	probably damaging	Het
Clmn	T	C	12: 104,785,428	D256G	possibly damaging	Het
Cobl	A	C	11: 12,256,225	M550R	possibly damaging	Het
Cracr2b	A	T	7: 141,464,205	T117S	probably benign	Het
Cx3cr1	G	A	9: 120,052,216	A40V	probably benign	Het
Cxcl14	A	G	13: 56,292,531	C72R	probably damaging	Het
Dab2	T	A	15: 6,422,266	I121N	probably damaging	Het
Dapk1	A	G	13: 60,751,176	Y820C	probably damaging	Het
Ech1	T	A	7: 28,826,198	C91S	probably damaging	Het
Exosc5	T	G	7: 25,659,309	V25G	probably benign	Het
Fam160a1	G	A	3: 85,672,564	S778L	probably benign	Het
Fbp1	A	C	13: 62,872,750	D122E	possibly damaging	Het
Fbxw13	A	G	9: 109,185,403	Y101H	unknown	Het
Fmnl1	T	A	11: 103,186,627	V271E	probably damaging	Het
Fuk	C	T	8: 110,890,331	G396S	possibly damaging	Het
Galnt1	T	A	18: 24,284,809	S545T	probably benign	Het
Galnt13	G	A	2: 54,516,564	V9M	possibly damaging	Het
Gatsl3	A	G	11: 4,221,897	S325G	not run	Het
Gm3550	A	G	18: 34,737,527	K38R	probably damaging	Het
Gm7995	A	T	14: 42,310,345	I45F		Het
Gpr137	C	T	19: 6,940,358	R134Q	possibly damaging	Het
Gpr22	T	G	12: 31,709,515	I203L	probably benign	Het
H2-Q10	T	C	17: 35,473,560	Y324H	not run	Het
Hcn4	G	A	9: 58,844,299	E403K	unknown	Het
Hddc2	T	A	10: 31,313,416	M1K	probably null	Het
Hps3	A	G	3: 20,035,165	F34S	probably damaging	Het
Igdcc4	G	T	9: 65,123,994	V405L	possibly damaging	Het
Itpr2	C	A	6: 146,329,508	V1215L	probably damaging	Het
Kif26b	T	C	1: 178,914,774	S812P	probably damaging	Het
Lgi1	T	A	19: 38,301,265	C260S	probably damaging	Het
Lhfp	A	G	3: 53,260,599	Y198C	probably damaging	Het
Lrp5	T	C	19: 3,649,439	D282G	probably benign	Het
Lrpprc	T	C	17: 84,772,139	T230A	probably damaging	Het
Lrtm2	A	G	6: 119,320,823	W86R	probably benign	Het
Magi2	G	A	5: 20,358,956	G199D	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
March7	T	A	2: 60,247,514		probably null	Het
Morc1	A	G	16: 48,431,345	D2G	probably damaging	Het
Mpp7	A	T	18: 7,351,079	F539L	probably damaging	Het
Muc13	A	T	16: 33,814,581	I502F	probably damaging	Het
Myh13	A	G	11: 67,364,460		probably null	Het
Nat10	C	G	2: 103,748,045	L238F	probably damaging	Het
Nckap1	G	A	2: 80,524,541	T679I	probably damaging	Het
Npy6r	T	A	18: 44,276,193	I227N	probably damaging	Het
Nudt18	A	T	14: 70,577,949	M1L	unknown	Het
Olfr1306	T	A	2: 111,912,292	I213L	probably benign	Het
Olfr26	C	A	9: 38,855,116	T18K	probably damaging	Het
Olfr270	T	A	4: 52,971,207	N195K	probably damaging	Het
Olfr298	G	A	7: 86,489,209	T114I	probably damaging	Het
Olfr52	T	C	2: 86,181,334	Y259C	probably damaging	Het
Pcdha3	T	A	18: 36,946,213	F3I	probably benign	Het
Pcdhga3	T	A	18: 37,675,864	Y457N	possibly damaging	Het
Pclo	A	T	5: 14,669,617	Q1256L	unknown	Het
Piezo2	C	T	18: 63,024,472	R2389H	probably damaging	Het
Pml	G	T	9: 58,247,213	Q126K	probably benign	Het
Ppef2	A	G	5: 92,228,704	Y655H	probably damaging	Het
Ppp4r1	T	C	17: 65,840,941	V926A	probably damaging	Het
Psg29	A	G	7: 17,211,723	D406G	possibly damaging	Het
Ptprf	T	C	4: 118,235,667	D517G	probably benign	Het
Ptprg	G	A	14: 12,142,461	E371K	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rasgrp1	T	A	2: 117,291,697	D404V	possibly damaging	Het
Rb1cc1	T	A	1: 6,245,503	F541I	probably damaging	Het
Rgsl1	C	A	1: 153,844,101		probably null	Het
Rhobtb2	C	T	14: 69,795,948	W524*	probably null	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rims1	A	G	1: 22,404,475	S211P		Het
Ripor2	A	T	13: 24,670,071	Q54L	possibly damaging	Het
Rnf213	A	G	11: 119,481,291	I4903V		Het
Robo3	T	A	9: 37,424,815	I452F	possibly damaging	Het
Seh1l	C	T	18: 67,783,918	H56Y	probably damaging	Het
Sema3b	T	A	9: 107,602,963	D192V	probably damaging	Het
Sidt1	A	T	16: 44,286,400	C222*	probably null	Het
Skor1	A	G	9: 63,146,103	F195L	probably damaging	Het
Slc44a2	A	C	9: 21,348,346	K596N	possibly damaging	Het
Smgc	A	G	15: 91,845,493	K217E	probably benign	Het
Socs7	C	A	11: 97,377,091	H349Q	possibly damaging	Het
Speer4f2	A	G	5: 17,376,542	T161A		Het
Spg11	T	C	2: 122,093,545		probably null	Het
Ssb	A	G	2: 69,863,280	T11A	probably benign	Het
Sun1	A	G	5: 139,246,834	S837G	probably damaging	Het
Szt2	A	C	4: 118,363,471	S3385A	unknown	Het
Tapbp	T	C	17: 33,920,417	V129A	possibly damaging	Het
Thsd1	T	C	8: 22,243,333	I132T	possibly damaging	Het
Tm6sf2	T	A	8: 70,077,939	V223E	possibly damaging	Het
Tm9sf4	T	A	2: 153,194,347	M343K	probably benign	Het
Tmem57	A	T	4: 134,828,279	N294K	possibly damaging	Het
Trank1	C	A	9: 111,366,349	P1147Q	probably benign	Het
Trip4	G	A	9: 65,866,475	T275M	probably damaging	Het
Tsen34	T	C	7: 3,695,835		probably null	Het
Ttc26	T	A	6: 38,404,487	Y319*	probably null	Het
Ttn	T	C	2: 76,850,078	E1086G	unknown	Het
Ubr4	A	T	4: 139,462,467	M853L	unknown	Het
Ubxn11	A	T	4: 134,125,155	R352W	probably damaging	Het
Vmn1r35	G	A	6: 66,679,235		probably benign	Het
Vmn2r107	C	T	17: 20,375,732	T849I	probably benign	Het
Vmn2r93	C	A	17: 18,325,986	L707I	probably benign	Het
Wwc1	G	A	11: 35,875,706	T574I	probably benign	Het
Zfp143	A	G	7: 110,070,498	M45V	probably benign	Het
Zfp518a	T	A	19: 40,914,157	N843K	possibly damaging	Het
Zfp87	A	T	13: 67,517,044	M433K	probably benign	Het
Zfp873	C	A	10: 82,060,627	H397Q	probably damaging	Het
Zscan21	A	T	5: 138,117,848		probably benign	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32645873	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32643924	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32643807	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACCTAGAGTTTCTGCTGAAGTGC -3'
(R):5'- AACGGTCAACTATGCCATTCTTC -3'

Sequencing Primer
(F):5'- CTGAAGTGCAGCCAGGG -3'
(R):5'- GGTCAACTATGCCATTCTTCTTCAC -3'

Posted On

2019-10-07