Incidental Mutation 'R7448:Atp8b5'
ID 577444
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene Name ATPase, class I, type 8B, member 5
Synonyms 4930417M19Rik, FetA
MMRRC Submission 045523-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7448 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43267159-43373833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 43366021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 764 (M764R)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
AlphaFold A3FIN4
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably benign
Transcript: ENSMUST00000107942
AA Change: M764R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: M764R

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T C 2: 155,360,186 (GRCm39) S54P probably damaging Het
Ahnak2 T C 12: 112,746,605 (GRCm39) K1242E Het
Alpi T A 1: 87,029,257 (GRCm39) M1L possibly damaging Het
Atp2c1 C T 9: 105,329,982 (GRCm39) A283T probably damaging Het
B4galnt2 T A 11: 95,760,193 (GRCm39) H278L probably damaging Het
Bcl9l G T 9: 44,420,634 (GRCm39) A1347S probably benign Het
Bicd2 A G 13: 49,533,427 (GRCm39) E671G probably damaging Het
Bmp3 A T 5: 99,020,077 (GRCm39) I167F probably damaging Het
Bpifb5 T A 2: 154,072,105 (GRCm39) C271S possibly damaging Het
Camsap2 T A 1: 136,198,644 (GRCm39) H793L Het
Casp8ap2 T A 4: 32,643,974 (GRCm39) S1016T possibly damaging Het
Castor1 A G 11: 4,171,897 (GRCm39) S325G not run Het
Ccdc134 T A 15: 82,025,149 (GRCm39) I216N possibly damaging Het
Ccdc63 G T 5: 122,246,245 (GRCm39) R559S probably benign Het
Cd276 T C 9: 58,442,895 (GRCm39) T187A probably benign Het
Ciao1 C T 2: 127,087,678 (GRCm39) R219H probably damaging Het
Clmn T C 12: 104,751,687 (GRCm39) D256G possibly damaging Het
Cobl A C 11: 12,206,225 (GRCm39) M550R possibly damaging Het
Cracr2b A T 7: 141,044,118 (GRCm39) T117S probably benign Het
Cx3cr1 G A 9: 119,881,282 (GRCm39) A40V probably benign Het
Cxcl14 A G 13: 56,440,344 (GRCm39) C72R probably damaging Het
Dab2 T A 15: 6,451,747 (GRCm39) I121N probably damaging Het
Dapk1 A G 13: 60,898,990 (GRCm39) Y820C probably damaging Het
Dele1 A G 18: 38,390,319 (GRCm39) N256D probably damaging Het
Ech1 T A 7: 28,525,623 (GRCm39) C91S probably damaging Het
Exosc5 T G 7: 25,358,734 (GRCm39) V25G probably benign Het
Fbp1 A C 13: 63,020,564 (GRCm39) D122E possibly damaging Het
Fbxw13 A G 9: 109,014,471 (GRCm39) Y101H unknown Het
Fcsk C T 8: 111,616,963 (GRCm39) G396S possibly damaging Het
Fhip1a G A 3: 85,579,871 (GRCm39) S778L probably benign Het
Fmnl1 T A 11: 103,077,453 (GRCm39) V271E probably damaging Het
Galnt1 T A 18: 24,417,866 (GRCm39) S545T probably benign Het
Galnt13 G A 2: 54,406,576 (GRCm39) V9M possibly damaging Het
Gm7995 A T 14: 42,132,302 (GRCm39) I45F Het
Gpr137 C T 19: 6,917,726 (GRCm39) R134Q possibly damaging Het
Gpr22 T G 12: 31,759,514 (GRCm39) I203L probably benign Het
H2-Q10 T C 17: 35,784,457 (GRCm39) Y324H not run Het
Hcn4 G A 9: 58,751,582 (GRCm39) E403K unknown Het
Hddc2 T A 10: 31,189,412 (GRCm39) M1K probably null Het
Hps3 A G 3: 20,089,329 (GRCm39) F34S probably damaging Het
Ift56 T A 6: 38,381,422 (GRCm39) Y319* probably null Het
Igdcc4 G T 9: 65,031,276 (GRCm39) V405L possibly damaging Het
Itpr2 C A 6: 146,231,006 (GRCm39) V1215L probably damaging Het
Kif26b T C 1: 178,742,339 (GRCm39) S812P probably damaging Het
Lgi1 T A 19: 38,289,713 (GRCm39) C260S probably damaging Het
Lhfpl6 A G 3: 53,168,020 (GRCm39) Y198C probably damaging Het
Lrp5 T C 19: 3,699,439 (GRCm39) D282G probably benign Het
Lrpprc T C 17: 85,079,567 (GRCm39) T230A probably damaging Het
Lrtm2 A G 6: 119,297,784 (GRCm39) W86R probably benign Het
Maco1 A T 4: 134,555,590 (GRCm39) N294K possibly damaging Het
Magi2 G A 5: 20,563,954 (GRCm39) G199D probably damaging Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Marchf7 T A 2: 60,077,858 (GRCm39) probably null Het
Morc1 A G 16: 48,251,708 (GRCm39) D2G probably damaging Het
Mpp7 A T 18: 7,351,079 (GRCm39) F539L probably damaging Het
Muc13 A T 16: 33,634,951 (GRCm39) I502F probably damaging Het
Myh13 A G 11: 67,255,286 (GRCm39) probably null Het
Nat10 C G 2: 103,578,390 (GRCm39) L238F probably damaging Het
Nckap1 G A 2: 80,354,885 (GRCm39) T679I probably damaging Het
Npy6r T A 18: 44,409,260 (GRCm39) I227N probably damaging Het
Nudt18 A T 14: 70,815,389 (GRCm39) M1L unknown Het
Or13d1 T A 4: 52,971,207 (GRCm39) N195K probably damaging Het
Or14a257 G A 7: 86,138,417 (GRCm39) T114I probably damaging Het
Or4f14 T A 2: 111,742,637 (GRCm39) I213L probably benign Het
Or8d1 C A 9: 38,766,412 (GRCm39) T18K probably damaging Het
Or8u8 T C 2: 86,011,678 (GRCm39) Y259C probably damaging Het
Pcdha3 T A 18: 37,079,266 (GRCm39) F3I probably benign Het
Pcdhga3 T A 18: 37,808,917 (GRCm39) Y457N possibly damaging Het
Pclo A T 5: 14,719,631 (GRCm39) Q1256L unknown Het
Piezo2 C T 18: 63,157,543 (GRCm39) R2389H probably damaging Het
Pml G T 9: 58,154,496 (GRCm39) Q126K probably benign Het
Ppef2 A G 5: 92,376,563 (GRCm39) Y655H probably damaging Het
Ppp4r1 T C 17: 66,147,936 (GRCm39) V926A probably damaging Het
Psg29 A G 7: 16,945,648 (GRCm39) D406G possibly damaging Het
Ptprf T C 4: 118,092,864 (GRCm39) D517G probably benign Het
Ptprg G A 14: 12,142,461 (GRCm38) E371K probably benign Het
Pttg1ip2 T C 5: 5,505,952 (GRCm39) I110V probably benign Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rasgrp1 T A 2: 117,122,178 (GRCm39) D404V possibly damaging Het
Rb1cc1 T A 1: 6,315,727 (GRCm39) F541I probably damaging Het
Rgsl1 C A 1: 153,719,847 (GRCm39) probably null Het
Rhobtb2 C T 14: 70,033,397 (GRCm39) W524* probably null Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rims1 A G 1: 22,474,699 (GRCm39) S211P Het
Ripor2 A T 13: 24,854,054 (GRCm39) Q54L possibly damaging Het
Rnf213 A G 11: 119,372,117 (GRCm39) I4903V Het
Robo3 T A 9: 37,336,111 (GRCm39) I452F possibly damaging Het
Rpl27rt A G 18: 34,870,580 (GRCm39) K38R probably damaging Het
Seh1l C T 18: 67,916,988 (GRCm39) H56Y probably damaging Het
Sema3b T A 9: 107,480,162 (GRCm39) D192V probably damaging Het
Sidt1 A T 16: 44,106,763 (GRCm39) C222* probably null Het
Skor1 A G 9: 63,053,385 (GRCm39) F195L probably damaging Het
Slc44a2 A C 9: 21,259,642 (GRCm39) K596N possibly damaging Het
Smgc A G 15: 91,729,696 (GRCm39) K217E probably benign Het
Socs7 C A 11: 97,267,917 (GRCm39) H349Q possibly damaging Het
Speer4f2 A G 5: 17,581,540 (GRCm39) T161A Het
Spg11 T C 2: 121,924,026 (GRCm39) probably null Het
Ssb A G 2: 69,693,624 (GRCm39) T11A probably benign Het
Sun1 A G 5: 139,232,589 (GRCm39) S837G probably damaging Het
Szt2 A C 4: 118,220,668 (GRCm39) S3385A unknown Het
Tapbp T C 17: 34,139,391 (GRCm39) V129A possibly damaging Het
Thsd1 T C 8: 22,733,349 (GRCm39) I132T possibly damaging Het
Tm6sf2 T A 8: 70,530,589 (GRCm39) V223E possibly damaging Het
Tm9sf4 T A 2: 153,036,267 (GRCm39) M343K probably benign Het
Trank1 C A 9: 111,195,417 (GRCm39) P1147Q probably benign Het
Trip4 G A 9: 65,773,757 (GRCm39) T275M probably damaging Het
Tsen34 T C 7: 3,698,834 (GRCm39) probably null Het
Ttn T C 2: 76,680,422 (GRCm39) E1086G unknown Het
Ubr4 A T 4: 139,189,778 (GRCm39) M853L unknown Het
Ubxn11 A T 4: 133,852,466 (GRCm39) R352W probably damaging Het
Vmn1r35 G A 6: 66,656,219 (GRCm39) probably benign Het
Vmn2r107 C T 17: 20,595,994 (GRCm39) T849I probably benign Het
Vmn2r93 C A 17: 18,546,248 (GRCm39) L707I probably benign Het
Wwc1 G A 11: 35,766,533 (GRCm39) T574I probably benign Het
Zfp143 A G 7: 109,669,705 (GRCm39) M45V probably benign Het
Zfp518a T A 19: 40,902,601 (GRCm39) N843K possibly damaging Het
Zfp87 A T 13: 67,665,163 (GRCm39) M433K probably benign Het
Zfp873 C A 10: 81,896,461 (GRCm39) H397Q probably damaging Het
Zscan21 A T 5: 138,116,110 (GRCm39) probably benign Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43,355,567 (GRCm39) missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43,311,938 (GRCm39) missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43,302,628 (GRCm39) missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43,368,010 (GRCm39) missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43,291,693 (GRCm39) missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43,366,638 (GRCm39) missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43,320,590 (GRCm39) critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43,364,167 (GRCm39) missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43,334,205 (GRCm39) missense probably benign
IGL02456:Atp8b5 APN 4 43,365,578 (GRCm39) missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43,369,634 (GRCm39) missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43,366,770 (GRCm39) missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43,305,774 (GRCm39) missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43,366,057 (GRCm39) missense probably benign
R0256:Atp8b5 UTSW 4 43,302,576 (GRCm39) intron probably benign
R0379:Atp8b5 UTSW 4 43,361,898 (GRCm39) missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43,291,672 (GRCm39) missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43,305,719 (GRCm39) intron probably benign
R1442:Atp8b5 UTSW 4 43,334,313 (GRCm39) missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43,302,590 (GRCm39) missense probably benign
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43,344,430 (GRCm39) missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43,355,673 (GRCm39) missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43,372,903 (GRCm39) missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43,372,906 (GRCm39) missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43,361,804 (GRCm39) missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43,357,063 (GRCm39) missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43,369,688 (GRCm39) missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43,370,726 (GRCm39) missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43,361,953 (GRCm39) splice site probably benign
R3023:Atp8b5 UTSW 4 43,311,957 (GRCm39) missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43,372,697 (GRCm39) missense probably benign
R3690:Atp8b5 UTSW 4 43,368,055 (GRCm39) missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43,365,591 (GRCm39) missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43,357,016 (GRCm39) missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43,365,955 (GRCm39) missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43,372,710 (GRCm39) missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43,308,504 (GRCm39) makesense probably null
R4784:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43,344,449 (GRCm39) missense probably benign
R5422:Atp8b5 UTSW 4 43,366,644 (GRCm39) missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43,370,577 (GRCm39) missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43,304,674 (GRCm39) missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43,371,003 (GRCm39) missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43,334,249 (GRCm39) missense probably benign
R6931:Atp8b5 UTSW 4 43,364,108 (GRCm39) critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43,355,618 (GRCm39) missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43,361,835 (GRCm39) missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43,357,018 (GRCm39) missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43,342,640 (GRCm39) missense probably benign 0.10
R7465:Atp8b5 UTSW 4 43,271,269 (GRCm39) missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43,366,609 (GRCm39) missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43,370,823 (GRCm39) critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43,366,735 (GRCm39) missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43,342,471 (GRCm39) missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43,356,982 (GRCm39) nonsense probably null
R8218:Atp8b5 UTSW 4 43,372,728 (GRCm39) critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43,366,072 (GRCm39) missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43,291,714 (GRCm39) missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43,342,439 (GRCm39) missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43,304,687 (GRCm39) missense
R8942:Atp8b5 UTSW 4 43,353,658 (GRCm39) missense probably damaging 1.00
R9153:Atp8b5 UTSW 4 43,308,493 (GRCm39) utr 3 prime probably benign
R9154:Atp8b5 UTSW 4 43,372,630 (GRCm39) missense probably benign 0.19
R9211:Atp8b5 UTSW 4 43,367,960 (GRCm39) missense probably damaging 0.97
R9361:Atp8b5 UTSW 4 43,369,658 (GRCm39) missense possibly damaging 0.80
R9786:Atp8b5 UTSW 4 43,305,798 (GRCm39) missense probably damaging 0.97
X0025:Atp8b5 UTSW 4 43,366,774 (GRCm39) missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43,361,903 (GRCm39) missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43,370,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATAACCCATGGCAGCCAAGG -3'
(R):5'- AGACGACTTTCAGGTAAGGGAC -3'

Sequencing Primer
(F):5'- TTCTGTAGGAGCCTAGGACC -3'
(R):5'- AGGGGAGTAGGGTCACCC -3'
Posted On 2019-10-07