Mutagenetix > Incidental Mutation

Incidental Mutation 'R7448:Ptprf'

577446

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase, receptor type, F

Synonyms

RPTP-LAR, LAR

MMRRC Submission

045523-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R7448 (G1)

Quality Score

213.009

Status

Validated

Chromosome

Chromosomal Location

118208213-118291405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118235667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 517 (D517G)

Ref Sequence

ENSEMBL: ENSMUSP00000039368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]

AlphaFold

A2A8L5

PDB Structure

Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000049074
AA Change: D517G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: D517G

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: D41G

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: D184G

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222620

Meta Mutation Damage Score

0.1429

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (117/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,257,266	N256D	probably damaging	Het
1700015F17Rik	T	C	5: 5,455,952	I110V	probably benign	Het
Acss2	T	C	2: 155,518,266	S54P	probably damaging	Het
Ahnak2	T	C	12: 112,782,502	K1242E		Het
Alpi	T	A	1: 87,101,535	M1L	possibly damaging	Het
Atp2c1	C	T	9: 105,452,783	A283T	probably damaging	Het
Atp8b5	T	G	4: 43,366,021	M764R	probably benign	Het
B4galnt2	T	A	11: 95,869,367	H278L	probably damaging	Het
Bcl9l	G	T	9: 44,509,337	A1347S	probably benign	Het
Bicd2	A	G	13: 49,379,951	E671G	probably damaging	Het
Bmp3	A	T	5: 98,872,218	I167F	probably damaging	Het
Bpifb5	T	A	2: 154,230,185	C271S	possibly damaging	Het
Camsap2	T	A	1: 136,270,906	H793L		Het
Casp8ap2	T	A	4: 32,643,974	S1016T	possibly damaging	Het
Ccdc134	T	A	15: 82,140,948	I216N	possibly damaging	Het
Ccdc63	G	T	5: 122,108,182	R559S	probably benign	Het
Cd276	T	C	9: 58,535,612	T187A	probably benign	Het
Ciao1	C	T	2: 127,245,758	R219H	probably damaging	Het
Clmn	T	C	12: 104,785,428	D256G	possibly damaging	Het
Cobl	A	C	11: 12,256,225	M550R	possibly damaging	Het
Cracr2b	A	T	7: 141,464,205	T117S	probably benign	Het
Cx3cr1	G	A	9: 120,052,216	A40V	probably benign	Het
Cxcl14	A	G	13: 56,292,531	C72R	probably damaging	Het
Dab2	T	A	15: 6,422,266	I121N	probably damaging	Het
Dapk1	A	G	13: 60,751,176	Y820C	probably damaging	Het
Ech1	T	A	7: 28,826,198	C91S	probably damaging	Het
Exosc5	T	G	7: 25,659,309	V25G	probably benign	Het
Fam160a1	G	A	3: 85,672,564	S778L	probably benign	Het
Fbp1	A	C	13: 62,872,750	D122E	possibly damaging	Het
Fbxw13	A	G	9: 109,185,403	Y101H	unknown	Het
Fmnl1	T	A	11: 103,186,627	V271E	probably damaging	Het
Fuk	C	T	8: 110,890,331	G396S	possibly damaging	Het
Galnt1	T	A	18: 24,284,809	S545T	probably benign	Het
Galnt13	G	A	2: 54,516,564	V9M	possibly damaging	Het
Gatsl3	A	G	11: 4,221,897	S325G	not run	Het
Gm3550	A	G	18: 34,737,527	K38R	probably damaging	Het
Gm7995	A	T	14: 42,310,345	I45F		Het
Gpr137	C	T	19: 6,940,358	R134Q	possibly damaging	Het
Gpr22	T	G	12: 31,709,515	I203L	probably benign	Het
H2-Q10	T	C	17: 35,473,560	Y324H	not run	Het
Hcn4	G	A	9: 58,844,299	E403K	unknown	Het
Hddc2	T	A	10: 31,313,416	M1K	probably null	Het
Hps3	A	G	3: 20,035,165	F34S	probably damaging	Het
Igdcc4	G	T	9: 65,123,994	V405L	possibly damaging	Het
Itpr2	C	A	6: 146,329,508	V1215L	probably damaging	Het
Kif26b	T	C	1: 178,914,774	S812P	probably damaging	Het
Lgi1	T	A	19: 38,301,265	C260S	probably damaging	Het
Lhfp	A	G	3: 53,260,599	Y198C	probably damaging	Het
Lrp5	T	C	19: 3,649,439	D282G	probably benign	Het
Lrpprc	T	C	17: 84,772,139	T230A	probably damaging	Het
Lrtm2	A	G	6: 119,320,823	W86R	probably benign	Het
Magi2	G	A	5: 20,358,956	G199D	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
March7	T	A	2: 60,247,514		probably null	Het
Morc1	A	G	16: 48,431,345	D2G	probably damaging	Het
Mpp7	A	T	18: 7,351,079	F539L	probably damaging	Het
Muc13	A	T	16: 33,814,581	I502F	probably damaging	Het
Myh13	A	G	11: 67,364,460		probably null	Het
Nat10	C	G	2: 103,748,045	L238F	probably damaging	Het
Nckap1	G	A	2: 80,524,541	T679I	probably damaging	Het
Npy6r	T	A	18: 44,276,193	I227N	probably damaging	Het
Nudt18	A	T	14: 70,577,949	M1L	unknown	Het
Olfr1306	T	A	2: 111,912,292	I213L	probably benign	Het
Olfr26	C	A	9: 38,855,116	T18K	probably damaging	Het
Olfr270	T	A	4: 52,971,207	N195K	probably damaging	Het
Olfr298	G	A	7: 86,489,209	T114I	probably damaging	Het
Olfr52	T	C	2: 86,181,334	Y259C	probably damaging	Het
Pcdha3	T	A	18: 36,946,213	F3I	probably benign	Het
Pcdhga3	T	A	18: 37,675,864	Y457N	possibly damaging	Het
Pclo	A	T	5: 14,669,617	Q1256L	unknown	Het
Piezo2	C	T	18: 63,024,472	R2389H	probably damaging	Het
Pml	G	T	9: 58,247,213	Q126K	probably benign	Het
Ppef2	A	G	5: 92,228,704	Y655H	probably damaging	Het
Ppp4r1	T	C	17: 65,840,941	V926A	probably damaging	Het
Psg29	A	G	7: 17,211,723	D406G	possibly damaging	Het
Ptprg	G	A	14: 12,142,461	E371K	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rasgrp1	T	A	2: 117,291,697	D404V	possibly damaging	Het
Rb1cc1	T	A	1: 6,245,503	F541I	probably damaging	Het
Rgsl1	C	A	1: 153,844,101		probably null	Het
Rhobtb2	C	T	14: 69,795,948	W524*	probably null	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rims1	A	G	1: 22,404,475	S211P		Het
Ripor2	A	T	13: 24,670,071	Q54L	possibly damaging	Het
Rnf213	A	G	11: 119,481,291	I4903V		Het
Robo3	T	A	9: 37,424,815	I452F	possibly damaging	Het
Seh1l	C	T	18: 67,783,918	H56Y	probably damaging	Het
Sema3b	T	A	9: 107,602,963	D192V	probably damaging	Het
Sidt1	A	T	16: 44,286,400	C222*	probably null	Het
Skor1	A	G	9: 63,146,103	F195L	probably damaging	Het
Slc44a2	A	C	9: 21,348,346	K596N	possibly damaging	Het
Smgc	A	G	15: 91,845,493	K217E	probably benign	Het
Socs7	C	A	11: 97,377,091	H349Q	possibly damaging	Het
Speer4f2	A	G	5: 17,376,542	T161A		Het
Spg11	T	C	2: 122,093,545		probably null	Het
Ssb	A	G	2: 69,863,280	T11A	probably benign	Het
Sun1	A	G	5: 139,246,834	S837G	probably damaging	Het
Szt2	A	C	4: 118,363,471	S3385A	unknown	Het
Tapbp	T	C	17: 33,920,417	V129A	possibly damaging	Het
Thsd1	T	C	8: 22,243,333	I132T	possibly damaging	Het
Tm6sf2	T	A	8: 70,077,939	V223E	possibly damaging	Het
Tm9sf4	T	A	2: 153,194,347	M343K	probably benign	Het
Tmem57	A	T	4: 134,828,279	N294K	possibly damaging	Het
Trank1	C	A	9: 111,366,349	P1147Q	probably benign	Het
Trip4	G	A	9: 65,866,475	T275M	probably damaging	Het
Tsen34	T	C	7: 3,695,835		probably null	Het
Ttc26	T	A	6: 38,404,487	Y319*	probably null	Het
Ttn	T	C	2: 76,850,078	E1086G	unknown	Het
Ubr4	A	T	4: 139,462,467	M853L	unknown	Het
Ubxn11	A	T	4: 134,125,155	R352W	probably damaging	Het
Vmn1r35	G	A	6: 66,679,235		probably benign	Het
Vmn2r107	C	T	17: 20,375,732	T849I	probably benign	Het
Vmn2r93	C	A	17: 18,325,986	L707I	probably benign	Het
Wwc1	G	A	11: 35,875,706	T574I	probably benign	Het
Zfp143	A	G	7: 110,070,498	M45V	probably benign	Het
Zfp518a	T	A	19: 40,914,157	N843K	possibly damaging	Het
Zfp87	A	T	13: 67,517,044	M433K	probably benign	Het
Zfp873	C	A	10: 82,060,627	H397Q	probably damaging	Het
Zscan21	A	T	5: 138,117,848		probably benign	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118223220	splice site	probably benign
IGL01337:Ptprf	APN	4	118236291	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118212454	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118248898	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118277370	missense	probably benign
IGL02189:Ptprf	APN	4	118213642	splice site	probably benign
IGL03067:Ptprf	APN	4	118210713	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118213612	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118223394	splice site	probably benign
R0788:Ptprf	UTSW	4	118226466	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118212105	nonsense	probably null
R1483:Ptprf	UTSW	4	118235964	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118236233	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118224899	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118223265	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118209871	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118223932	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118269172	splice site	probably benign
R2406:Ptprf	UTSW	4	118269304	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118248980	missense	probably damaging	0.98
R3111:Ptprf	UTSW	4	118211432	missense	probably damaging	1.00
R3498:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118224930	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118237883	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118257608	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118226452	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118226083	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118211022	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118212217	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118225039	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118210329	intron	probably benign
R4857:Ptprf	UTSW	4	118217197	splice site	probably benign
R5071:Ptprf	UTSW	4	118211999	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118225108	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118236389	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118235634	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118226338	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118226041	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118224924	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118236177	nonsense	probably null
R5860:Ptprf	UTSW	4	118211289	intron	probably benign
R5869:Ptprf	UTSW	4	118210382	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118224735	missense	probably benign
R5932:Ptprf	UTSW	4	118211767	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118213629	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118211048	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118210755	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118211084	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118223256	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118212814	missense	probably benign
R6741:Ptprf	UTSW	4	118223368	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118236365	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118231731	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118269277	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118223904	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118231543	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118231669	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118211125	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118257492	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118212814	missense	probably benign
R7399:Ptprf	UTSW	4	118226523	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118212172	missense	probably damaging	1.00
R7530:Ptprf	UTSW	4	118212748	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118212396	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118211078	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118212112	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118226279	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118226066	missense	probably benign	0.27
R8441:Ptprf	UTSW	4	118218058	splice site	probably benign
R8681:Ptprf	UTSW	4	118231647	missense	probably benign	0.02
R8771:Ptprf	UTSW	4	118211790	missense	possibly damaging	0.95
R8815:Ptprf	UTSW	4	118237928	missense	possibly damaging	0.52
R8998:Ptprf	UTSW	4	118226474	missense	probably benign	0.00
R8999:Ptprf	UTSW	4	118226474	missense	probably benign	0.00
R9389:Ptprf	UTSW	4	118236039	missense	probably benign
R9508:Ptprf	UTSW	4	118269579	nonsense	probably null
R9581:Ptprf	UTSW	4	118235060	missense	probably benign	0.00
X0067:Ptprf	UTSW	4	118236026	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118269615	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GTATCACACGGGCCACTAAC -3'
(R):5'- CAGGCTGTGAAGTTTGGAGC -3'

Sequencing Primer
(F):5'- AAACCTAGGGTCTGCAGCC -3'
(R):5'- AAGTTTGGAGCTTGGGAGG -3'

Posted On

2019-10-07