Incidental Mutation 'R7448:Ptprf'
ID577446
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R7448 (G1)
Quality Score213.009
Status Validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118235667 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 517 (D517G)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]
PDB Structure
Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: D517G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: D517G

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: D41G

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: D184G

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222620
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Itpr2 C A 6: 146,329,508 V1215L probably damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rb1cc1 T A 1: 6,245,503 F541I probably damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trank1 C A 9: 111,366,349 P1147Q probably benign Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Tsen34 T C 7: 3,695,835 probably null Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Wwc1 G A 11: 35,875,706 T574I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118224924 missense probably damaging 1.00
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
R8172:Ptprf UTSW 4 118211078 missense probably benign 0.03
R8239:Ptprf UTSW 4 118212112 missense possibly damaging 0.88
R8257:Ptprf UTSW 4 118226279 missense probably damaging 0.96
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118269615 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTATCACACGGGCCACTAAC -3'
(R):5'- CAGGCTGTGAAGTTTGGAGC -3'

Sequencing Primer
(F):5'- AAACCTAGGGTCTGCAGCC -3'
(R):5'- AAGTTTGGAGCTTGGGAGG -3'
Posted On2019-10-07