Incidental Mutation 'R7448:Szt2'
ID 577447
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 045523-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.649) question?
Stock # R7448 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 118220668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 3385 (S3385A)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006562] [ENSMUST00000075406] [ENSMUST00000106393] [ENSMUST00000194248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006562
SMART Domains Protein: ENSMUSP00000006562
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
Pfam:AP_endonuc_2 24 221 4.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: S3385A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S3385A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106393
SMART Domains Protein: ENSMUSP00000102001
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
SCOP:d1k77a_ 4 67 4e-10 SMART
PDB:1K77|A 5 69 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Predicted Effect probably benign
Transcript: ENSMUST00000194248
SMART Domains Protein: ENSMUSP00000141952
Gene: ENSMUSG00000006395

DomainStartEndE-ValueType
SCOP:d1k77a_ 4 77 3e-10 SMART
PDB:1K77|A 5 76 6e-8 PDB
low complexity region 246 260 N/A INTRINSIC
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T C 2: 155,360,186 (GRCm39) S54P probably damaging Het
Ahnak2 T C 12: 112,746,605 (GRCm39) K1242E Het
Alpi T A 1: 87,029,257 (GRCm39) M1L possibly damaging Het
Atp2c1 C T 9: 105,329,982 (GRCm39) A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 (GRCm39) M764R probably benign Het
B4galnt2 T A 11: 95,760,193 (GRCm39) H278L probably damaging Het
Bcl9l G T 9: 44,420,634 (GRCm39) A1347S probably benign Het
Bicd2 A G 13: 49,533,427 (GRCm39) E671G probably damaging Het
Bmp3 A T 5: 99,020,077 (GRCm39) I167F probably damaging Het
Bpifb5 T A 2: 154,072,105 (GRCm39) C271S possibly damaging Het
Camsap2 T A 1: 136,198,644 (GRCm39) H793L Het
Casp8ap2 T A 4: 32,643,974 (GRCm39) S1016T possibly damaging Het
Castor1 A G 11: 4,171,897 (GRCm39) S325G not run Het
Ccdc134 T A 15: 82,025,149 (GRCm39) I216N possibly damaging Het
Ccdc63 G T 5: 122,246,245 (GRCm39) R559S probably benign Het
Cd276 T C 9: 58,442,895 (GRCm39) T187A probably benign Het
Ciao1 C T 2: 127,087,678 (GRCm39) R219H probably damaging Het
Clmn T C 12: 104,751,687 (GRCm39) D256G possibly damaging Het
Cobl A C 11: 12,206,225 (GRCm39) M550R possibly damaging Het
Cracr2b A T 7: 141,044,118 (GRCm39) T117S probably benign Het
Cx3cr1 G A 9: 119,881,282 (GRCm39) A40V probably benign Het
Cxcl14 A G 13: 56,440,344 (GRCm39) C72R probably damaging Het
Dab2 T A 15: 6,451,747 (GRCm39) I121N probably damaging Het
Dapk1 A G 13: 60,898,990 (GRCm39) Y820C probably damaging Het
Dele1 A G 18: 38,390,319 (GRCm39) N256D probably damaging Het
Ech1 T A 7: 28,525,623 (GRCm39) C91S probably damaging Het
Exosc5 T G 7: 25,358,734 (GRCm39) V25G probably benign Het
Fbp1 A C 13: 63,020,564 (GRCm39) D122E possibly damaging Het
Fbxw13 A G 9: 109,014,471 (GRCm39) Y101H unknown Het
Fcsk C T 8: 111,616,963 (GRCm39) G396S possibly damaging Het
Fhip1a G A 3: 85,579,871 (GRCm39) S778L probably benign Het
Fmnl1 T A 11: 103,077,453 (GRCm39) V271E probably damaging Het
Galnt1 T A 18: 24,417,866 (GRCm39) S545T probably benign Het
Galnt13 G A 2: 54,406,576 (GRCm39) V9M possibly damaging Het
Gm7995 A T 14: 42,132,302 (GRCm39) I45F Het
Gpr137 C T 19: 6,917,726 (GRCm39) R134Q possibly damaging Het
Gpr22 T G 12: 31,759,514 (GRCm39) I203L probably benign Het
H2-Q10 T C 17: 35,784,457 (GRCm39) Y324H not run Het
Hcn4 G A 9: 58,751,582 (GRCm39) E403K unknown Het
Hddc2 T A 10: 31,189,412 (GRCm39) M1K probably null Het
Hps3 A G 3: 20,089,329 (GRCm39) F34S probably damaging Het
Ift56 T A 6: 38,381,422 (GRCm39) Y319* probably null Het
Igdcc4 G T 9: 65,031,276 (GRCm39) V405L possibly damaging Het
Itpr2 C A 6: 146,231,006 (GRCm39) V1215L probably damaging Het
Kif26b T C 1: 178,742,339 (GRCm39) S812P probably damaging Het
Lgi1 T A 19: 38,289,713 (GRCm39) C260S probably damaging Het
Lhfpl6 A G 3: 53,168,020 (GRCm39) Y198C probably damaging Het
Lrp5 T C 19: 3,699,439 (GRCm39) D282G probably benign Het
Lrpprc T C 17: 85,079,567 (GRCm39) T230A probably damaging Het
Lrtm2 A G 6: 119,297,784 (GRCm39) W86R probably benign Het
Maco1 A T 4: 134,555,590 (GRCm39) N294K possibly damaging Het
Magi2 G A 5: 20,563,954 (GRCm39) G199D probably damaging Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Marchf7 T A 2: 60,077,858 (GRCm39) probably null Het
Morc1 A G 16: 48,251,708 (GRCm39) D2G probably damaging Het
Mpp7 A T 18: 7,351,079 (GRCm39) F539L probably damaging Het
Muc13 A T 16: 33,634,951 (GRCm39) I502F probably damaging Het
Myh13 A G 11: 67,255,286 (GRCm39) probably null Het
Nat10 C G 2: 103,578,390 (GRCm39) L238F probably damaging Het
Nckap1 G A 2: 80,354,885 (GRCm39) T679I probably damaging Het
Npy6r T A 18: 44,409,260 (GRCm39) I227N probably damaging Het
Nudt18 A T 14: 70,815,389 (GRCm39) M1L unknown Het
Or13d1 T A 4: 52,971,207 (GRCm39) N195K probably damaging Het
Or14a257 G A 7: 86,138,417 (GRCm39) T114I probably damaging Het
Or4f14 T A 2: 111,742,637 (GRCm39) I213L probably benign Het
Or8d1 C A 9: 38,766,412 (GRCm39) T18K probably damaging Het
Or8u8 T C 2: 86,011,678 (GRCm39) Y259C probably damaging Het
Pcdha3 T A 18: 37,079,266 (GRCm39) F3I probably benign Het
Pcdhga3 T A 18: 37,808,917 (GRCm39) Y457N possibly damaging Het
Pclo A T 5: 14,719,631 (GRCm39) Q1256L unknown Het
Piezo2 C T 18: 63,157,543 (GRCm39) R2389H probably damaging Het
Pml G T 9: 58,154,496 (GRCm39) Q126K probably benign Het
Ppef2 A G 5: 92,376,563 (GRCm39) Y655H probably damaging Het
Ppp4r1 T C 17: 66,147,936 (GRCm39) V926A probably damaging Het
Psg29 A G 7: 16,945,648 (GRCm39) D406G possibly damaging Het
Ptprf T C 4: 118,092,864 (GRCm39) D517G probably benign Het
Ptprg G A 14: 12,142,461 (GRCm38) E371K probably benign Het
Pttg1ip2 T C 5: 5,505,952 (GRCm39) I110V probably benign Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rasgrp1 T A 2: 117,122,178 (GRCm39) D404V possibly damaging Het
Rb1cc1 T A 1: 6,315,727 (GRCm39) F541I probably damaging Het
Rgsl1 C A 1: 153,719,847 (GRCm39) probably null Het
Rhobtb2 C T 14: 70,033,397 (GRCm39) W524* probably null Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rims1 A G 1: 22,474,699 (GRCm39) S211P Het
Ripor2 A T 13: 24,854,054 (GRCm39) Q54L possibly damaging Het
Rnf213 A G 11: 119,372,117 (GRCm39) I4903V Het
Robo3 T A 9: 37,336,111 (GRCm39) I452F possibly damaging Het
Rpl27rt A G 18: 34,870,580 (GRCm39) K38R probably damaging Het
Seh1l C T 18: 67,916,988 (GRCm39) H56Y probably damaging Het
Sema3b T A 9: 107,480,162 (GRCm39) D192V probably damaging Het
Sidt1 A T 16: 44,106,763 (GRCm39) C222* probably null Het
Skor1 A G 9: 63,053,385 (GRCm39) F195L probably damaging Het
Slc44a2 A C 9: 21,259,642 (GRCm39) K596N possibly damaging Het
Smgc A G 15: 91,729,696 (GRCm39) K217E probably benign Het
Socs7 C A 11: 97,267,917 (GRCm39) H349Q possibly damaging Het
Speer4f2 A G 5: 17,581,540 (GRCm39) T161A Het
Spg11 T C 2: 121,924,026 (GRCm39) probably null Het
Ssb A G 2: 69,693,624 (GRCm39) T11A probably benign Het
Sun1 A G 5: 139,232,589 (GRCm39) S837G probably damaging Het
Tapbp T C 17: 34,139,391 (GRCm39) V129A possibly damaging Het
Thsd1 T C 8: 22,733,349 (GRCm39) I132T possibly damaging Het
Tm6sf2 T A 8: 70,530,589 (GRCm39) V223E possibly damaging Het
Tm9sf4 T A 2: 153,036,267 (GRCm39) M343K probably benign Het
Trank1 C A 9: 111,195,417 (GRCm39) P1147Q probably benign Het
Trip4 G A 9: 65,773,757 (GRCm39) T275M probably damaging Het
Tsen34 T C 7: 3,698,834 (GRCm39) probably null Het
Ttn T C 2: 76,680,422 (GRCm39) E1086G unknown Het
Ubr4 A T 4: 139,189,778 (GRCm39) M853L unknown Het
Ubxn11 A T 4: 133,852,466 (GRCm39) R352W probably damaging Het
Vmn1r35 G A 6: 66,656,219 (GRCm39) probably benign Het
Vmn2r107 C T 17: 20,595,994 (GRCm39) T849I probably benign Het
Vmn2r93 C A 17: 18,546,248 (GRCm39) L707I probably benign Het
Wwc1 G A 11: 35,766,533 (GRCm39) T574I probably benign Het
Zfp143 A G 7: 109,669,705 (GRCm39) M45V probably benign Het
Zfp518a T A 19: 40,902,601 (GRCm39) N843K possibly damaging Het
Zfp87 A T 13: 67,665,163 (GRCm39) M433K probably benign Het
Zfp873 C A 10: 81,896,461 (GRCm39) H397Q probably damaging Het
Zscan21 A T 5: 138,116,110 (GRCm39) probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCTAAGTGCCAGTCTG -3'
(R):5'- GTTTCTGGACTCACACCTGG -3'

Sequencing Primer
(F):5'- CGGGCAAGCTTATAGATCCATGATTC -3'
(R):5'- TTTCTGGACTCACACCTGGGAAAG -3'
Posted On 2019-10-07