Incidental Mutation 'R7448:Itpr2'
ID577463
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7448 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146329508 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1215 (V1215L)
Ref Sequence ENSEMBL: ENSMUSP00000049584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
Predicted Effect probably damaging
Transcript: ENSMUST00000053273
AA Change: V1215L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: V1215L

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079573
AA Change: V1182L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: V1182L

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprf T C 4: 118,235,667 D517G probably benign Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rb1cc1 T A 1: 6,245,503 F541I probably damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trank1 C A 9: 111,366,349 P1147Q probably benign Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Tsen34 T C 7: 3,695,835 probably null Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Wwc1 G A 11: 35,875,706 T574I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
dollar_short UTSW 6 146397019 nonsense probably null
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146373208 missense probably benign 0.06
R7492:Itpr2 UTSW 6 146390938 missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146327110 missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146194598 missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146390865 missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146233994 missense probably benign 0.36
R7678:Itpr2 UTSW 6 146187550 missense probably benign 0.00
R7790:Itpr2 UTSW 6 146224776 missense probably damaging 1.00
R7798:Itpr2 UTSW 6 146386015 missense probably benign 0.06
R7831:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R7914:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R8023:Itpr2 UTSW 6 146187490 missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146426459 missense probably damaging 0.96
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCCTTGTGCATAGGAAATAAG -3'
(R):5'- CAGATGAAACCGCTTCCTCTG -3'

Sequencing Primer
(F):5'- CCCTTGTGCATAGGAAATAAGAGAAG -3'
(R):5'- TCTGTGCGCATAGGCAC -3'
Posted On2019-10-07