Mutagenetix > Incidental Mutation

Incidental Mutation 'R7448:Itpr2'

577463

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7448 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 146329508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1215 (V1215L)

Ref Sequence

ENSEMBL: ENSMUSP00000049584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053273
AA Change: V1215L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: V1215L

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000079573
AA Change: V1182L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: V1182L

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (117/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,257,266	N256D	probably damaging	Het
1700015F17Rik	T	C	5: 5,455,952	I110V	probably benign	Het
Acss2	T	C	2: 155,518,266	S54P	probably damaging	Het
Ahnak2	T	C	12: 112,782,502	K1242E		Het
Alpi	T	A	1: 87,101,535	M1L	possibly damaging	Het
Atp2c1	C	T	9: 105,452,783	A283T	probably damaging	Het
Atp8b5	T	G	4: 43,366,021	M764R	probably benign	Het
B4galnt2	T	A	11: 95,869,367	H278L	probably damaging	Het
Bcl9l	G	T	9: 44,509,337	A1347S	probably benign	Het
Bicd2	A	G	13: 49,379,951	E671G	probably damaging	Het
Bmp3	A	T	5: 98,872,218	I167F	probably damaging	Het
Bpifb5	T	A	2: 154,230,185	C271S	possibly damaging	Het
Camsap2	T	A	1: 136,270,906	H793L		Het
Casp8ap2	T	A	4: 32,643,974	S1016T	possibly damaging	Het
Ccdc134	T	A	15: 82,140,948	I216N	possibly damaging	Het
Ccdc63	G	T	5: 122,108,182	R559S	probably benign	Het
Cd276	T	C	9: 58,535,612	T187A	probably benign	Het
Ciao1	C	T	2: 127,245,758	R219H	probably damaging	Het
Clmn	T	C	12: 104,785,428	D256G	possibly damaging	Het
Cobl	A	C	11: 12,256,225	M550R	possibly damaging	Het
Cracr2b	A	T	7: 141,464,205	T117S	probably benign	Het
Cx3cr1	G	A	9: 120,052,216	A40V	probably benign	Het
Cxcl14	A	G	13: 56,292,531	C72R	probably damaging	Het
Dab2	T	A	15: 6,422,266	I121N	probably damaging	Het
Dapk1	A	G	13: 60,751,176	Y820C	probably damaging	Het
Ech1	T	A	7: 28,826,198	C91S	probably damaging	Het
Exosc5	T	G	7: 25,659,309	V25G	probably benign	Het
Fam160a1	G	A	3: 85,672,564	S778L	probably benign	Het
Fbp1	A	C	13: 62,872,750	D122E	possibly damaging	Het
Fbxw13	A	G	9: 109,185,403	Y101H	unknown	Het
Fmnl1	T	A	11: 103,186,627	V271E	probably damaging	Het
Fuk	C	T	8: 110,890,331	G396S	possibly damaging	Het
Galnt1	T	A	18: 24,284,809	S545T	probably benign	Het
Galnt13	G	A	2: 54,516,564	V9M	possibly damaging	Het
Gatsl3	A	G	11: 4,221,897	S325G	not run	Het
Gm3550	A	G	18: 34,737,527	K38R	probably damaging	Het
Gm7995	A	T	14: 42,310,345	I45F		Het
Gpr137	C	T	19: 6,940,358	R134Q	possibly damaging	Het
Gpr22	T	G	12: 31,709,515	I203L	probably benign	Het
H2-Q10	T	C	17: 35,473,560	Y324H	not run	Het
Hcn4	G	A	9: 58,844,299	E403K	unknown	Het
Hddc2	T	A	10: 31,313,416	M1K	probably null	Het
Hps3	A	G	3: 20,035,165	F34S	probably damaging	Het
Igdcc4	G	T	9: 65,123,994	V405L	possibly damaging	Het
Kif26b	T	C	1: 178,914,774	S812P	probably damaging	Het
Lgi1	T	A	19: 38,301,265	C260S	probably damaging	Het
Lhfp	A	G	3: 53,260,599	Y198C	probably damaging	Het
Lrp5	T	C	19: 3,649,439	D282G	probably benign	Het
Lrpprc	T	C	17: 84,772,139	T230A	probably damaging	Het
Lrtm2	A	G	6: 119,320,823	W86R	probably benign	Het
Magi2	G	A	5: 20,358,956	G199D	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
March7	T	A	2: 60,247,514		probably null	Het
Morc1	A	G	16: 48,431,345	D2G	probably damaging	Het
Mpp7	A	T	18: 7,351,079	F539L	probably damaging	Het
Muc13	A	T	16: 33,814,581	I502F	probably damaging	Het
Myh13	A	G	11: 67,364,460		probably null	Het
Nat10	C	G	2: 103,748,045	L238F	probably damaging	Het
Nckap1	G	A	2: 80,524,541	T679I	probably damaging	Het
Npy6r	T	A	18: 44,276,193	I227N	probably damaging	Het
Nudt18	A	T	14: 70,577,949	M1L	unknown	Het
Olfr1306	T	A	2: 111,912,292	I213L	probably benign	Het
Olfr26	C	A	9: 38,855,116	T18K	probably damaging	Het
Olfr270	T	A	4: 52,971,207	N195K	probably damaging	Het
Olfr298	G	A	7: 86,489,209	T114I	probably damaging	Het
Olfr52	T	C	2: 86,181,334	Y259C	probably damaging	Het
Pcdha3	T	A	18: 36,946,213	F3I	probably benign	Het
Pcdhga3	T	A	18: 37,675,864	Y457N	possibly damaging	Het
Pclo	A	T	5: 14,669,617	Q1256L	unknown	Het
Piezo2	C	T	18: 63,024,472	R2389H	probably damaging	Het
Pml	G	T	9: 58,247,213	Q126K	probably benign	Het
Ppef2	A	G	5: 92,228,704	Y655H	probably damaging	Het
Ppp4r1	T	C	17: 65,840,941	V926A	probably damaging	Het
Psg29	A	G	7: 17,211,723	D406G	possibly damaging	Het
Ptprf	T	C	4: 118,235,667	D517G	probably benign	Het
Ptprg	G	A	14: 12,142,461	E371K	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rasgrp1	T	A	2: 117,291,697	D404V	possibly damaging	Het
Rb1cc1	T	A	1: 6,245,503	F541I	probably damaging	Het
Rgsl1	C	A	1: 153,844,101		probably null	Het
Rhobtb2	C	T	14: 69,795,948	W524*	probably null	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rims1	A	G	1: 22,404,475	S211P		Het
Ripor2	A	T	13: 24,670,071	Q54L	possibly damaging	Het
Rnf213	A	G	11: 119,481,291	I4903V		Het
Robo3	T	A	9: 37,424,815	I452F	possibly damaging	Het
Seh1l	C	T	18: 67,783,918	H56Y	probably damaging	Het
Sema3b	T	A	9: 107,602,963	D192V	probably damaging	Het
Sidt1	A	T	16: 44,286,400	C222*	probably null	Het
Skor1	A	G	9: 63,146,103	F195L	probably damaging	Het
Slc44a2	A	C	9: 21,348,346	K596N	possibly damaging	Het
Smgc	A	G	15: 91,845,493	K217E	probably benign	Het
Socs7	C	A	11: 97,377,091	H349Q	possibly damaging	Het
Speer4f2	A	G	5: 17,376,542	T161A		Het
Spg11	T	C	2: 122,093,545		probably null	Het
Ssb	A	G	2: 69,863,280	T11A	probably benign	Het
Sun1	A	G	5: 139,246,834	S837G	probably damaging	Het
Szt2	A	C	4: 118,363,471	S3385A	unknown	Het
Tapbp	T	C	17: 33,920,417	V129A	possibly damaging	Het
Thsd1	T	C	8: 22,243,333	I132T	possibly damaging	Het
Tm6sf2	T	A	8: 70,077,939	V223E	possibly damaging	Het
Tm9sf4	T	A	2: 153,194,347	M343K	probably benign	Het
Tmem57	A	T	4: 134,828,279	N294K	possibly damaging	Het
Trank1	C	A	9: 111,366,349	P1147Q	probably benign	Het
Trip4	G	A	9: 65,866,475	T275M	probably damaging	Het
Tsen34	T	C	7: 3,695,835		probably null	Het
Ttc26	T	A	6: 38,404,487	Y319*	probably null	Het
Ttn	T	C	2: 76,850,078	E1086G	unknown	Het
Ubr4	A	T	4: 139,462,467	M853L	unknown	Het
Ubxn11	A	T	4: 134,125,155	R352W	probably damaging	Het
Vmn1r35	G	A	6: 66,679,235		probably benign	Het
Vmn2r107	C	T	17: 20,375,732	T849I	probably benign	Het
Vmn2r93	C	A	17: 18,325,986	L707I	probably benign	Het
Wwc1	G	A	11: 35,875,706	T574I	probably benign	Het
Zfp143	A	G	7: 110,070,498	M45V	probably benign	Het
Zfp518a	T	A	19: 40,914,157	N843K	possibly damaging	Het
Zfp87	A	T	13: 67,517,044	M433K	probably benign	Het
Zfp873	C	A	10: 82,060,627	H397Q	probably damaging	Het
Zscan21	A	T	5: 138,117,848		probably benign	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4453001:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1779:Itpr2	UTSW	6	146158901	nonsense	probably null
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8046:Itpr2	UTSW	6	146426459	missense	probably damaging	0.96
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8324:Itpr2	UTSW	6	146328398	missense	probably damaging	0.97
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCCCTTGTGCATAGGAAATAAG -3'
(R):5'- CAGATGAAACCGCTTCCTCTG -3'

Sequencing Primer
(F):5'- CCCTTGTGCATAGGAAATAAGAGAAG -3'
(R):5'- TCTGTGCGCATAGGCAC -3'

Posted On

2019-10-07