Incidental Mutation 'R7448:Tsen34'
ID 577464
Institutional Source Beutler Lab
Gene Symbol Tsen34
Ensembl Gene ENSMUSG00000035585
Gene Name tRNA splicing endonuclease subunit 34
Synonyms Leng5, 0610027F08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock # R7448 (G1)
Quality Score 111.008
Status Validated
Chromosome 7
Chromosomal Location 3692863-3701024 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3695835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038521] [ENSMUST00000038608] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000118710] [ENSMUST00000123088] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000137204] [ENSMUST00000142713] [ENSMUST00000155060] [ENSMUST00000205287] [ENSMUST00000205734] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
AlphaFold Q8BMZ5
Predicted Effect probably benign
Transcript: ENSMUST00000038521
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038608
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108627
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108629
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108630
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123088
SMART Domains Protein: ENSMUSP00000123614
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127106
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128364
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137204
SMART Domains Protein: ENSMUSP00000120403
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142713
SMART Domains Protein: ENSMUSP00000118440
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205287
Predicted Effect probably benign
Transcript: ENSMUST00000205734
Predicted Effect probably benign
Transcript: ENSMUST00000206343
Predicted Effect probably benign
Transcript: ENSMUST00000206379
Predicted Effect probably benign
Transcript: ENSMUST00000206571
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Itpr2 C A 6: 146,329,508 V1215L probably damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprf T C 4: 118,235,667 D517G probably benign Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rb1cc1 T A 1: 6,245,503 F541I probably damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trank1 C A 9: 111,366,349 P1147Q probably benign Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Wwc1 G A 11: 35,875,706 T574I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Tsen34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tsen34 APN 7 3700531 makesense probably null
R1612:Tsen34 UTSW 7 3695396 missense probably damaging 0.99
R2441:Tsen34 UTSW 7 3694995 missense possibly damaging 0.92
R4455:Tsen34 UTSW 7 3695098 splice site probably null
R4702:Tsen34 UTSW 7 3700633 missense probably damaging 1.00
R4870:Tsen34 UTSW 7 3694381 unclassified probably benign
R5950:Tsen34 UTSW 7 3694788 missense probably null 0.97
R6221:Tsen34 UTSW 7 3695544 missense probably damaging 0.99
R6266:Tsen34 UTSW 7 3693985 unclassified probably benign
R7121:Tsen34 UTSW 7 3694987 missense probably benign 0.18
R7134:Tsen34 UTSW 7 3700641 missense probably damaging 0.98
R7190:Tsen34 UTSW 7 3694807 missense possibly damaging 0.94
R7345:Tsen34 UTSW 7 3695615 missense probably damaging 1.00
R7743:Tsen34 UTSW 7 3694602 missense possibly damaging 0.54
R7887:Tsen34 UTSW 7 3694708 missense probably damaging 1.00
R8723:Tsen34 UTSW 7 3695150 missense probably benign 0.00
R8916:Tsen34 UTSW 7 3694341 unclassified probably benign
RF020:Tsen34 UTSW 7 3695796 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGGTGACTTCCTGGTCTATCC -3'
(R):5'- GCAGTGAATGCGCTCATATG -3'

Sequencing Primer
(F):5'- GGACTCTGGTGGCTGTACC -3'
(R):5'- CAGTGAATGCGCTCATATGTTTTG -3'
Posted On 2019-10-07