Incidental Mutation 'R0629:Myo7a'
ID57748
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98085466 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 607 (L607R)
Ref Sequence ENSEMBL: ENSMUSP00000146165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000205746]
Predicted Effect probably damaging
Transcript: ENSMUST00000084979
AA Change: L607R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: L607R

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: L613R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: L613R

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107127
AA Change: L618R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: L618R

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107128
AA Change: L618R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: L618R

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152975
Predicted Effect probably damaging
Transcript: ENSMUST00000205746
AA Change: L607R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9662 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6465:Myo7a UTSW 7 98062680 missense possibly damaging 0.95
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
R7526:Myo7a UTSW 7 98085448 missense possibly damaging 0.49
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACAGGCACTCTACAATCTTCAGGC -3'
(R):5'- TACCCCTTGACTGACCTTGGTGAC -3'

Sequencing Primer
(F):5'- CAAGGACACCGAGGCAC -3'
(R):5'- GACTGACCTTGGTGACCTTCC -3'
Posted On2013-07-11