Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Myo7a'

57748

Institutional Source

Beutler Lab

Gene Symbol

Myo7a

Ensembl Gene

ENSMUSG00000030761

Gene Name

myosin VIIA

Synonyms

Myo7, nmf371, polka, Hdb, USH1B

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98051060-98119524 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 98085466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 607 (L607R)

Ref Sequence

ENSEMBL: ENSMUSP00000146165 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000205746]

AlphaFold

P97479

Predicted Effect

probably damaging
Transcript: ENSMUST00000084979
AA Change: L607R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: L607R

Domain	Start	End	E-Value	Type
MYSc	48	731	N/A	SMART
IQ	732	754	2.99e0	SMART
IQ	755	777	8.77e-7	SMART
IQ	801	823	8e0	SMART
IQ	824	846	8.7e0	SMART
low complexity region	854	889	N/A	INTRINSIC
low complexity region	893	916	N/A	INTRINSIC
low complexity region	972	985	N/A	INTRINSIC
MyTH4	1006	1242	1.4e-71	SMART
B41	1243	1458	8.82e-42	SMART
SH3	1557	1622	4.93e-7	SMART
MyTH4	1698	1847	3.95e-57	SMART
B41	1849	2066	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107122
AA Change: L613R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: L613R

Domain	Start	End	E-Value	Type
MYSc	48	737	N/A	SMART
IQ	738	760	2.99e0	SMART
IQ	761	783	8.77e-7	SMART
IQ	807	829	8e0	SMART
IQ	830	852	8.7e0	SMART
low complexity region	860	895	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	978	991	N/A	INTRINSIC
MyTH4	1012	1248	1.4e-71	SMART
B41	1249	1464	8.82e-42	SMART
SH3	1563	1628	4.93e-7	SMART
MyTH4	1704	1853	3.95e-57	SMART
B41	1855	2072	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107127
AA Change: L618R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: L618R

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1568	1633	4.93e-7	SMART
MyTH4	1709	1858	3.95e-57	SMART
B41	1860	2077	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107128
AA Change: L618R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: L618R

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1606	1671	4.93e-7	SMART
MyTH4	1747	1896	3.95e-57	SMART
B41	1898	2115	8.27e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152975

Predicted Effect

probably damaging
Transcript: ENSMUST00000205746
AA Change: L607R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9662

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Myo7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Myo7a	APN	7	98102626	missense	probably damaging	1.00
IGL00785:Myo7a	APN	7	98054348	missense	probably damaging	0.99
IGL00840:Myo7a	APN	7	98051659	missense	probably benign	0.25
IGL01362:Myo7a	APN	7	98097702	missense	probably damaging	1.00
IGL01484:Myo7a	APN	7	98085422	missense	probably damaging	1.00
IGL01673:Myo7a	APN	7	98054708	missense	probably benign	0.00
IGL01933:Myo7a	APN	7	98083142	missense	probably damaging	1.00
IGL01943:Myo7a	APN	7	98065647	missense	possibly damaging	0.96
IGL02188:Myo7a	APN	7	98091027	missense	probably damaging	0.96
IGL02304:Myo7a	APN	7	98077736	missense	possibly damaging	0.89
IGL02305:Myo7a	APN	7	98051629	makesense	probably null
IGL02331:Myo7a	APN	7	98053182	missense	possibly damaging	0.95
IGL02386:Myo7a	APN	7	98075112	missense	probably damaging	0.99
IGL02389:Myo7a	APN	7	98106991	critical splice donor site	probably null
IGL02832:Myo7a	APN	7	98091020	critical splice donor site	probably null
IGL02839:Myo7a	APN	7	98091122	missense	probably damaging	1.00
IGL03193:Myo7a	APN	7	98091057	missense	probably damaging	1.00
IGL03237:Myo7a	APN	7	98102593	missense	probably damaging	1.00
IGL03384:Myo7a	APN	7	98093593	missense	probably damaging	1.00
coward	UTSW	7	98085466	missense	probably damaging	1.00
H8786:Myo7a	UTSW	7	98095778	missense	possibly damaging	0.61
IGL03046:Myo7a	UTSW	7	98079327	missense	probably damaging	1.00
IGL03134:Myo7a	UTSW	7	98056767	missense	probably damaging	0.96
PIT4696001:Myo7a	UTSW	7	98063599	missense	probably benign	0.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0267:Myo7a	UTSW	7	98054624	missense	probably benign	0.08
R0408:Myo7a	UTSW	7	98056781	missense	probably damaging	1.00
R0411:Myo7a	UTSW	7	98071937	missense	probably benign	0.00
R0540:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0607:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0632:Myo7a	UTSW	7	98112150	intron	probably benign
R0659:Myo7a	UTSW	7	98054338	splice site	probably benign
R0735:Myo7a	UTSW	7	98081180	splice site	probably benign
R0924:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R0930:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R1018:Myo7a	UTSW	7	98107005	missense	probably damaging	1.00
R1196:Myo7a	UTSW	7	98097673	missense	possibly damaging	0.87
R1331:Myo7a	UTSW	7	98107008	missense	probably benign	0.00
R1487:Myo7a	UTSW	7	98053810	critical splice donor site	probably null
R1676:Myo7a	UTSW	7	98099472	critical splice donor site	probably null
R1695:Myo7a	UTSW	7	98092496	missense	possibly damaging	0.94
R1770:Myo7a	UTSW	7	98112606	intron	probably benign
R1781:Myo7a	UTSW	7	98073124	missense	probably damaging	1.00
R1789:Myo7a	UTSW	7	98107095	missense	probably damaging	0.99
R1827:Myo7a	UTSW	7	98076731	missense	probably damaging	0.99
R1864:Myo7a	UTSW	7	98052256	missense	probably damaging	1.00
R1955:Myo7a	UTSW	7	98054921	missense	probably damaging	1.00
R2011:Myo7a	UTSW	7	98054708	missense	possibly damaging	0.69
R2229:Myo7a	UTSW	7	98054910	missense	probably benign	0.12
R2259:Myo7a	UTSW	7	98069499	missense	probably damaging	1.00
R2443:Myo7a	UTSW	7	98095769	missense	probably benign	0.07
R2898:Myo7a	UTSW	7	98054424	nonsense	probably null
R2898:Myo7a	UTSW	7	98097206	missense	probably damaging	1.00
R3158:Myo7a	UTSW	7	98052292	missense	probably damaging	1.00
R3408:Myo7a	UTSW	7	98081087	missense	probably benign	0.00
R4222:Myo7a	UTSW	7	98073229	missense	possibly damaging	0.93
R4255:Myo7a	UTSW	7	98071964	missense	probably damaging	0.96
R4374:Myo7a	UTSW	7	98102674	missense	probably damaging	1.00
R4429:Myo7a	UTSW	7	98053188	missense	probably damaging	0.99
R4445:Myo7a	UTSW	7	98066404	missense	probably damaging	1.00
R4579:Myo7a	UTSW	7	98073193	missense	probably damaging	1.00
R4659:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R5073:Myo7a	UTSW	7	98073218	nonsense	probably null
R5138:Myo7a	UTSW	7	98083599	missense	probably damaging	1.00
R5566:Myo7a	UTSW	7	98064816	missense	possibly damaging	0.93
R5580:Myo7a	UTSW	7	98073160	missense	probably damaging	1.00
R6079:Myo7a	UTSW	7	98065790	nonsense	probably null
R6138:Myo7a	UTSW	7	98065790	nonsense	probably null
R6451:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6452:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6453:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6454:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6455:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6465:Myo7a	UTSW	7	98062680	missense	possibly damaging	0.95
R6653:Myo7a	UTSW	7	98054503	missense	probably damaging	0.96
R6709:Myo7a	UTSW	7	98054699	missense	probably damaging	1.00
R6917:Myo7a	UTSW	7	98095763	missense	possibly damaging	0.58
R7313:Myo7a	UTSW	7	98064195	missense	probably damaging	0.99
R7334:Myo7a	UTSW	7	98079366	missense	probably benign
R7356:Myo7a	UTSW	7	98102683	missense	probably benign	0.01
R7393:Myo7a	UTSW	7	98063699	missense	possibly damaging	0.91
R7422:Myo7a	UTSW	7	98051626	splice site	probably null
R7472:Myo7a	UTSW	7	98064793	missense	probably damaging	1.00
R7483:Myo7a	UTSW	7	98063674	missense	probably benign	0.07
R7526:Myo7a	UTSW	7	98085448	missense	possibly damaging	0.49
R7948:Myo7a	UTSW	7	98075029	missense	probably damaging	1.00
R8069:Myo7a	UTSW	7	98083626	nonsense	probably null
R8115:Myo7a	UTSW	7	98066446	missense	probably damaging	0.98
R8150:Myo7a	UTSW	7	98063639	missense	probably benign	0.19
R8265:Myo7a	UTSW	7	98085397	missense	probably benign	0.00
R8289:Myo7a	UTSW	7	98077169	missense	probably benign
R8298:Myo7a	UTSW	7	98098334	missense	probably damaging	1.00
R8518:Myo7a	UTSW	7	98091063	missense	possibly damaging	0.58
R8539:Myo7a	UTSW	7	98072461	missense	probably damaging	0.99
R8557:Myo7a	UTSW	7	98053874	missense	probably benign	0.08
R8685:Myo7a	UTSW	7	98097127	missense	probably benign	0.03
R8902:Myo7a	UTSW	7	98092613	missense	probably damaging	1.00
R9034:Myo7a	UTSW	7	98079258	missense	probably benign	0.40
R9090:Myo7a	UTSW	7	98091074	missense	probably benign	0.04
R9172:Myo7a	UTSW	7	98083162	missense	probably benign
R9271:Myo7a	UTSW	7	98091074	missense	probably benign	0.04
R9334:Myo7a	UTSW	7	98067162	missense	probably damaging	1.00
R9356:Myo7a	UTSW	7	98076666	missense	probably benign	0.11
R9444:Myo7a	UTSW	7	98093491	missense	possibly damaging	0.84
R9459:Myo7a	UTSW	7	98073173	missense	possibly damaging	0.65
R9513:Myo7a	UTSW	7	98097611	critical splice donor site	probably null
R9517:Myo7a	UTSW	7	98071959	missense	probably damaging	1.00
R9629:Myo7a	UTSW	7	98063730	missense	probably benign	0.03
R9662:Myo7a	UTSW	7	98098292	missense	possibly damaging	0.55
R9709:Myo7a	UTSW	7	98094329	missense	possibly damaging	0.79
RF005:Myo7a	UTSW	7	98093617	missense	probably benign	0.42
U15987:Myo7a	UTSW	7	98065790	nonsense	probably null
X0028:Myo7a	UTSW	7	98065725	missense	probably damaging	1.00
X0058:Myo7a	UTSW	7	98062648	missense	probably benign	0.02
Z1176:Myo7a	UTSW	7	98095727	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98052226	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98085523	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACAGGCACTCTACAATCTTCAGGC -3'
(R):5'- TACCCCTTGACTGACCTTGGTGAC -3'

Sequencing Primer
(F):5'- CAAGGACACCGAGGCAC -3'
(R):5'- GACTGACCTTGGTGACCTTCC -3'

Posted On

2013-07-11