Incidental Mutation 'R7448:Trank1'
ID577486
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7448 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111366349 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1147 (P1147Q)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: P1147Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: P1147Q

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Itpr2 C A 6: 146,329,508 V1215L probably damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprf T C 4: 118,235,667 D517G probably benign Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rb1cc1 T A 1: 6,245,503 F541I probably damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Tsen34 T C 7: 3,695,835 probably null Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Wwc1 G A 11: 35,875,706 T574I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7967:Trank1 UTSW 9 111392516 missense probably benign
R7993:Trank1 UTSW 9 111391528 missense probably benign 0.04
R8064:Trank1 UTSW 9 111352076 nonsense probably null
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense not run
Z1177:Trank1 UTSW 9 111367377 missense not run
Z1177:Trank1 UTSW 9 111392870 missense not run
Predicted Primers PCR Primer
(F):5'- TGAGTACGCCGTGATTGACC -3'
(R):5'- CTGATGTAGATGCTCCAGCTG -3'

Sequencing Primer
(F):5'- GTACGCCGTGATTGACCTCAAC -3'
(R):5'- AGATGCTCCAGCTGGTGTG -3'
Posted On2019-10-07