Incidental Mutation 'R7448:Wwc1'
ID 577492
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene Name WW, C2 and coiled-coil domain containing 1
Synonyms Kibra
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_170779.1; MGI: 2388637

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7448 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 35838400-35980527 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35875706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 574 (T574I)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
AlphaFold Q5SXA9
Predicted Effect probably benign
Transcript: ENSMUST00000018993
AA Change: T574I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: T574I

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype Strain: 5301655
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,257,266 N256D probably damaging Het
1700015F17Rik T C 5: 5,455,952 I110V probably benign Het
Acss2 T C 2: 155,518,266 S54P probably damaging Het
Ahnak2 T C 12: 112,782,502 K1242E Het
Alpi T A 1: 87,101,535 M1L possibly damaging Het
Atp2c1 C T 9: 105,452,783 A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 M764R probably benign Het
B4galnt2 T A 11: 95,869,367 H278L probably damaging Het
Bcl9l G T 9: 44,509,337 A1347S probably benign Het
Bicd2 A G 13: 49,379,951 E671G probably damaging Het
Bmp3 A T 5: 98,872,218 I167F probably damaging Het
Bpifb5 T A 2: 154,230,185 C271S possibly damaging Het
Camsap2 T A 1: 136,270,906 H793L Het
Casp8ap2 T A 4: 32,643,974 S1016T possibly damaging Het
Ccdc134 T A 15: 82,140,948 I216N possibly damaging Het
Ccdc63 G T 5: 122,108,182 R559S probably benign Het
Cd276 T C 9: 58,535,612 T187A probably benign Het
Ciao1 C T 2: 127,245,758 R219H probably damaging Het
Clmn T C 12: 104,785,428 D256G possibly damaging Het
Cobl A C 11: 12,256,225 M550R possibly damaging Het
Cracr2b A T 7: 141,464,205 T117S probably benign Het
Cx3cr1 G A 9: 120,052,216 A40V probably benign Het
Cxcl14 A G 13: 56,292,531 C72R probably damaging Het
Dab2 T A 15: 6,422,266 I121N probably damaging Het
Dapk1 A G 13: 60,751,176 Y820C probably damaging Het
Ech1 T A 7: 28,826,198 C91S probably damaging Het
Exosc5 T G 7: 25,659,309 V25G probably benign Het
Fam160a1 G A 3: 85,672,564 S778L probably benign Het
Fbp1 A C 13: 62,872,750 D122E possibly damaging Het
Fbxw13 A G 9: 109,185,403 Y101H unknown Het
Fmnl1 T A 11: 103,186,627 V271E probably damaging Het
Fuk C T 8: 110,890,331 G396S possibly damaging Het
Galnt1 T A 18: 24,284,809 S545T probably benign Het
Galnt13 G A 2: 54,516,564 V9M possibly damaging Het
Gatsl3 A G 11: 4,221,897 S325G not run Het
Gm3550 A G 18: 34,737,527 K38R probably damaging Het
Gm7995 A T 14: 42,310,345 I45F Het
Gpr137 C T 19: 6,940,358 R134Q possibly damaging Het
Gpr22 T G 12: 31,709,515 I203L probably benign Het
H2-Q10 T C 17: 35,473,560 Y324H not run Het
Hcn4 G A 9: 58,844,299 E403K unknown Het
Hddc2 T A 10: 31,313,416 M1K probably null Het
Hps3 A G 3: 20,035,165 F34S probably damaging Het
Igdcc4 G T 9: 65,123,994 V405L possibly damaging Het
Itpr2 C A 6: 146,329,508 V1215L probably damaging Het
Kif26b T C 1: 178,914,774 S812P probably damaging Het
Lgi1 T A 19: 38,301,265 C260S probably damaging Het
Lhfp A G 3: 53,260,599 Y198C probably damaging Het
Lrp5 T C 19: 3,649,439 D282G probably benign Het
Lrpprc T C 17: 84,772,139 T230A probably damaging Het
Lrtm2 A G 6: 119,320,823 W86R probably benign Het
Magi2 G A 5: 20,358,956 G199D probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
March7 T A 2: 60,247,514 probably null Het
Morc1 A G 16: 48,431,345 D2G probably damaging Het
Mpp7 A T 18: 7,351,079 F539L probably damaging Het
Muc13 A T 16: 33,814,581 I502F probably damaging Het
Myh13 A G 11: 67,364,460 probably null Het
Nat10 C G 2: 103,748,045 L238F probably damaging Het
Nckap1 G A 2: 80,524,541 T679I probably damaging Het
Npy6r T A 18: 44,276,193 I227N probably damaging Het
Nudt18 A T 14: 70,577,949 M1L unknown Het
Olfr1306 T A 2: 111,912,292 I213L probably benign Het
Olfr26 C A 9: 38,855,116 T18K probably damaging Het
Olfr270 T A 4: 52,971,207 N195K probably damaging Het
Olfr298 G A 7: 86,489,209 T114I probably damaging Het
Olfr52 T C 2: 86,181,334 Y259C probably damaging Het
Pcdha3 T A 18: 36,946,213 F3I probably benign Het
Pcdhga3 T A 18: 37,675,864 Y457N possibly damaging Het
Pclo A T 5: 14,669,617 Q1256L unknown Het
Piezo2 C T 18: 63,024,472 R2389H probably damaging Het
Pml G T 9: 58,247,213 Q126K probably benign Het
Ppef2 A G 5: 92,228,704 Y655H probably damaging Het
Ppp4r1 T C 17: 65,840,941 V926A probably damaging Het
Psg29 A G 7: 17,211,723 D406G possibly damaging Het
Ptprf T C 4: 118,235,667 D517G probably benign Het
Ptprg G A 14: 12,142,461 E371K probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rasgrp1 T A 2: 117,291,697 D404V possibly damaging Het
Rb1cc1 T A 1: 6,245,503 F541I probably damaging Het
Rgsl1 C A 1: 153,844,101 probably null Het
Rhobtb2 C T 14: 69,795,948 W524* probably null Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rims1 A G 1: 22,404,475 S211P Het
Ripor2 A T 13: 24,670,071 Q54L possibly damaging Het
Rnf213 A G 11: 119,481,291 I4903V Het
Robo3 T A 9: 37,424,815 I452F possibly damaging Het
Seh1l C T 18: 67,783,918 H56Y probably damaging Het
Sema3b T A 9: 107,602,963 D192V probably damaging Het
Sidt1 A T 16: 44,286,400 C222* probably null Het
Skor1 A G 9: 63,146,103 F195L probably damaging Het
Slc44a2 A C 9: 21,348,346 K596N possibly damaging Het
Smgc A G 15: 91,845,493 K217E probably benign Het
Socs7 C A 11: 97,377,091 H349Q possibly damaging Het
Speer4f2 A G 5: 17,376,542 T161A Het
Spg11 T C 2: 122,093,545 probably null Het
Ssb A G 2: 69,863,280 T11A probably benign Het
Sun1 A G 5: 139,246,834 S837G probably damaging Het
Szt2 A C 4: 118,363,471 S3385A unknown Het
Tapbp T C 17: 33,920,417 V129A possibly damaging Het
Thsd1 T C 8: 22,243,333 I132T possibly damaging Het
Tm6sf2 T A 8: 70,077,939 V223E possibly damaging Het
Tm9sf4 T A 2: 153,194,347 M343K probably benign Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Trank1 C A 9: 111,366,349 P1147Q probably benign Het
Trip4 G A 9: 65,866,475 T275M probably damaging Het
Tsen34 T C 7: 3,695,835 probably null Het
Ttc26 T A 6: 38,404,487 Y319* probably null Het
Ttn T C 2: 76,850,078 E1086G unknown Het
Ubr4 A T 4: 139,462,467 M853L unknown Het
Ubxn11 A T 4: 134,125,155 R352W probably damaging Het
Vmn1r35 G A 6: 66,679,235 probably benign Het
Vmn2r107 C T 17: 20,375,732 T849I probably benign Het
Vmn2r93 C A 17: 18,325,986 L707I probably benign Het
Zfp143 A G 7: 110,070,498 M45V probably benign Het
Zfp518a T A 19: 40,914,157 N843K possibly damaging Het
Zfp87 A T 13: 67,517,044 M433K probably benign Het
Zfp873 C A 10: 82,060,627 H397Q probably damaging Het
Zscan21 A T 5: 138,117,848 probably benign Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35844202 missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35867276 missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35898618 critical splice donor site probably null
IGL01771:Wwc1 APN 11 35853358 critical splice donor site probably null
IGL01804:Wwc1 APN 11 35841924 missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35876058 missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35844151 splice site probably benign
IGL03376:Wwc1 APN 11 35852294 missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35915284 missense possibly damaging 0.94
BB002:Wwc1 UTSW 11 35844163 missense probably benign 0.00
BB012:Wwc1 UTSW 11 35844163 missense probably benign 0.00
P0008:Wwc1 UTSW 11 35853351 splice site probably benign
R0277:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0321:Wwc1 UTSW 11 35841810 nonsense probably null
R0323:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35853472 missense probably benign 0.18
R1302:Wwc1 UTSW 11 35844157 missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35861844 missense probably benign
R1870:Wwc1 UTSW 11 35861945 missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35876547 missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35889353 missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35841887 missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35870528 missense probably benign 0.01
R2680:Wwc1 UTSW 11 35875929 missense probably benign 0.23
R3864:Wwc1 UTSW 11 35910316 missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35867296 missense probably benign
R4926:Wwc1 UTSW 11 35889400 missense probably benign 0.17
R4980:Wwc1 UTSW 11 35888103 missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35876566 missense probably benign 0.00
R5044:Wwc1 UTSW 11 35883345 missense probably benign 0.45
R5238:Wwc1 UTSW 11 35875896 missense probably benign 0.02
R5421:Wwc1 UTSW 11 35876063 missense possibly damaging 0.81
R5421:Wwc1 UTSW 11 35910296 missense possibly damaging 0.93
R5461:Wwc1 UTSW 11 35867372 missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35876596 missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35867326 missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35852336 missense probably benign 0.17
R6006:Wwc1 UTSW 11 35870982 missense probably null 1.00
R6006:Wwc1 UTSW 11 35889273 missense probably damaging 0.98
R6516:Wwc1 UTSW 11 35867302 missense probably benign 0.05
R6519:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6520:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6525:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6526:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6527:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6528:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R7060:Wwc1 UTSW 11 35915176 missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35897374 critical splice donor site probably null
R7586:Wwc1 UTSW 11 35844195 missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35869109 missense probably benign 0.21
R7925:Wwc1 UTSW 11 35844163 missense probably benign 0.00
R8296:Wwc1 UTSW 11 35870557 splice site probably benign
R8369:Wwc1 UTSW 11 35867371 missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35883407 missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35883317 missense probably benign 0.30
R9081:Wwc1 UTSW 11 35891504 missense probably benign 0.12
R9281:Wwc1 UTSW 11 35889384 missense probably benign 0.03
X0025:Wwc1 UTSW 11 35876040 missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35883482 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCCCATTCTACATTTGTCAGTG -3'
(R):5'- ATGACCCGTTCGAGCAGTTG -3'

Sequencing Primer
(F):5'- ATTCTACATTTGTCAGTGTTTACCG -3'
(R):5'- CGTTCGAGCAGTTGGACTC -3'
Posted On 2019-10-07