Incidental Mutation 'R7448:Dapk1'
ID 577504
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission 045523-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7448 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60898990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 820 (Y820C)
Ref Sequence ENSEMBL: ENSMUSP00000076666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: Y820C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: Y820C

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: Y820C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: Y820C

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: Y820C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (117/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T C 2: 155,360,186 (GRCm39) S54P probably damaging Het
Ahnak2 T C 12: 112,746,605 (GRCm39) K1242E Het
Alpi T A 1: 87,029,257 (GRCm39) M1L possibly damaging Het
Atp2c1 C T 9: 105,329,982 (GRCm39) A283T probably damaging Het
Atp8b5 T G 4: 43,366,021 (GRCm39) M764R probably benign Het
B4galnt2 T A 11: 95,760,193 (GRCm39) H278L probably damaging Het
Bcl9l G T 9: 44,420,634 (GRCm39) A1347S probably benign Het
Bicd2 A G 13: 49,533,427 (GRCm39) E671G probably damaging Het
Bmp3 A T 5: 99,020,077 (GRCm39) I167F probably damaging Het
Bpifb5 T A 2: 154,072,105 (GRCm39) C271S possibly damaging Het
Camsap2 T A 1: 136,198,644 (GRCm39) H793L Het
Casp8ap2 T A 4: 32,643,974 (GRCm39) S1016T possibly damaging Het
Castor1 A G 11: 4,171,897 (GRCm39) S325G not run Het
Ccdc134 T A 15: 82,025,149 (GRCm39) I216N possibly damaging Het
Ccdc63 G T 5: 122,246,245 (GRCm39) R559S probably benign Het
Cd276 T C 9: 58,442,895 (GRCm39) T187A probably benign Het
Ciao1 C T 2: 127,087,678 (GRCm39) R219H probably damaging Het
Clmn T C 12: 104,751,687 (GRCm39) D256G possibly damaging Het
Cobl A C 11: 12,206,225 (GRCm39) M550R possibly damaging Het
Cracr2b A T 7: 141,044,118 (GRCm39) T117S probably benign Het
Cx3cr1 G A 9: 119,881,282 (GRCm39) A40V probably benign Het
Cxcl14 A G 13: 56,440,344 (GRCm39) C72R probably damaging Het
Dab2 T A 15: 6,451,747 (GRCm39) I121N probably damaging Het
Dele1 A G 18: 38,390,319 (GRCm39) N256D probably damaging Het
Ech1 T A 7: 28,525,623 (GRCm39) C91S probably damaging Het
Exosc5 T G 7: 25,358,734 (GRCm39) V25G probably benign Het
Fbp1 A C 13: 63,020,564 (GRCm39) D122E possibly damaging Het
Fbxw13 A G 9: 109,014,471 (GRCm39) Y101H unknown Het
Fcsk C T 8: 111,616,963 (GRCm39) G396S possibly damaging Het
Fhip1a G A 3: 85,579,871 (GRCm39) S778L probably benign Het
Fmnl1 T A 11: 103,077,453 (GRCm39) V271E probably damaging Het
Galnt1 T A 18: 24,417,866 (GRCm39) S545T probably benign Het
Galnt13 G A 2: 54,406,576 (GRCm39) V9M possibly damaging Het
Gm7995 A T 14: 42,132,302 (GRCm39) I45F Het
Gpr137 C T 19: 6,917,726 (GRCm39) R134Q possibly damaging Het
Gpr22 T G 12: 31,759,514 (GRCm39) I203L probably benign Het
H2-Q10 T C 17: 35,784,457 (GRCm39) Y324H not run Het
Hcn4 G A 9: 58,751,582 (GRCm39) E403K unknown Het
Hddc2 T A 10: 31,189,412 (GRCm39) M1K probably null Het
Hps3 A G 3: 20,089,329 (GRCm39) F34S probably damaging Het
Ift56 T A 6: 38,381,422 (GRCm39) Y319* probably null Het
Igdcc4 G T 9: 65,031,276 (GRCm39) V405L possibly damaging Het
Itpr2 C A 6: 146,231,006 (GRCm39) V1215L probably damaging Het
Kif26b T C 1: 178,742,339 (GRCm39) S812P probably damaging Het
Lgi1 T A 19: 38,289,713 (GRCm39) C260S probably damaging Het
Lhfpl6 A G 3: 53,168,020 (GRCm39) Y198C probably damaging Het
Lrp5 T C 19: 3,699,439 (GRCm39) D282G probably benign Het
Lrpprc T C 17: 85,079,567 (GRCm39) T230A probably damaging Het
Lrtm2 A G 6: 119,297,784 (GRCm39) W86R probably benign Het
Maco1 A T 4: 134,555,590 (GRCm39) N294K possibly damaging Het
Magi2 G A 5: 20,563,954 (GRCm39) G199D probably damaging Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Marchf7 T A 2: 60,077,858 (GRCm39) probably null Het
Morc1 A G 16: 48,251,708 (GRCm39) D2G probably damaging Het
Mpp7 A T 18: 7,351,079 (GRCm39) F539L probably damaging Het
Muc13 A T 16: 33,634,951 (GRCm39) I502F probably damaging Het
Myh13 A G 11: 67,255,286 (GRCm39) probably null Het
Nat10 C G 2: 103,578,390 (GRCm39) L238F probably damaging Het
Nckap1 G A 2: 80,354,885 (GRCm39) T679I probably damaging Het
Npy6r T A 18: 44,409,260 (GRCm39) I227N probably damaging Het
Nudt18 A T 14: 70,815,389 (GRCm39) M1L unknown Het
Or13d1 T A 4: 52,971,207 (GRCm39) N195K probably damaging Het
Or14a257 G A 7: 86,138,417 (GRCm39) T114I probably damaging Het
Or4f14 T A 2: 111,742,637 (GRCm39) I213L probably benign Het
Or8d1 C A 9: 38,766,412 (GRCm39) T18K probably damaging Het
Or8u8 T C 2: 86,011,678 (GRCm39) Y259C probably damaging Het
Pcdha3 T A 18: 37,079,266 (GRCm39) F3I probably benign Het
Pcdhga3 T A 18: 37,808,917 (GRCm39) Y457N possibly damaging Het
Pclo A T 5: 14,719,631 (GRCm39) Q1256L unknown Het
Piezo2 C T 18: 63,157,543 (GRCm39) R2389H probably damaging Het
Pml G T 9: 58,154,496 (GRCm39) Q126K probably benign Het
Ppef2 A G 5: 92,376,563 (GRCm39) Y655H probably damaging Het
Ppp4r1 T C 17: 66,147,936 (GRCm39) V926A probably damaging Het
Psg29 A G 7: 16,945,648 (GRCm39) D406G possibly damaging Het
Ptprf T C 4: 118,092,864 (GRCm39) D517G probably benign Het
Ptprg G A 14: 12,142,461 (GRCm38) E371K probably benign Het
Pttg1ip2 T C 5: 5,505,952 (GRCm39) I110V probably benign Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rasgrp1 T A 2: 117,122,178 (GRCm39) D404V possibly damaging Het
Rb1cc1 T A 1: 6,315,727 (GRCm39) F541I probably damaging Het
Rgsl1 C A 1: 153,719,847 (GRCm39) probably null Het
Rhobtb2 C T 14: 70,033,397 (GRCm39) W524* probably null Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rims1 A G 1: 22,474,699 (GRCm39) S211P Het
Ripor2 A T 13: 24,854,054 (GRCm39) Q54L possibly damaging Het
Rnf213 A G 11: 119,372,117 (GRCm39) I4903V Het
Robo3 T A 9: 37,336,111 (GRCm39) I452F possibly damaging Het
Rpl27rt A G 18: 34,870,580 (GRCm39) K38R probably damaging Het
Seh1l C T 18: 67,916,988 (GRCm39) H56Y probably damaging Het
Sema3b T A 9: 107,480,162 (GRCm39) D192V probably damaging Het
Sidt1 A T 16: 44,106,763 (GRCm39) C222* probably null Het
Skor1 A G 9: 63,053,385 (GRCm39) F195L probably damaging Het
Slc44a2 A C 9: 21,259,642 (GRCm39) K596N possibly damaging Het
Smgc A G 15: 91,729,696 (GRCm39) K217E probably benign Het
Socs7 C A 11: 97,267,917 (GRCm39) H349Q possibly damaging Het
Speer4f2 A G 5: 17,581,540 (GRCm39) T161A Het
Spg11 T C 2: 121,924,026 (GRCm39) probably null Het
Ssb A G 2: 69,693,624 (GRCm39) T11A probably benign Het
Sun1 A G 5: 139,232,589 (GRCm39) S837G probably damaging Het
Szt2 A C 4: 118,220,668 (GRCm39) S3385A unknown Het
Tapbp T C 17: 34,139,391 (GRCm39) V129A possibly damaging Het
Thsd1 T C 8: 22,733,349 (GRCm39) I132T possibly damaging Het
Tm6sf2 T A 8: 70,530,589 (GRCm39) V223E possibly damaging Het
Tm9sf4 T A 2: 153,036,267 (GRCm39) M343K probably benign Het
Trank1 C A 9: 111,195,417 (GRCm39) P1147Q probably benign Het
Trip4 G A 9: 65,773,757 (GRCm39) T275M probably damaging Het
Tsen34 T C 7: 3,698,834 (GRCm39) probably null Het
Ttn T C 2: 76,680,422 (GRCm39) E1086G unknown Het
Ubr4 A T 4: 139,189,778 (GRCm39) M853L unknown Het
Ubxn11 A T 4: 133,852,466 (GRCm39) R352W probably damaging Het
Vmn1r35 G A 6: 66,656,219 (GRCm39) probably benign Het
Vmn2r107 C T 17: 20,595,994 (GRCm39) T849I probably benign Het
Vmn2r93 C A 17: 18,546,248 (GRCm39) L707I probably benign Het
Wwc1 G A 11: 35,766,533 (GRCm39) T574I probably benign Het
Zfp143 A G 7: 109,669,705 (GRCm39) M45V probably benign Het
Zfp518a T A 19: 40,902,601 (GRCm39) N843K possibly damaging Het
Zfp87 A T 13: 67,665,163 (GRCm39) M433K probably benign Het
Zfp873 C A 10: 81,896,461 (GRCm39) H397Q probably damaging Het
Zscan21 A T 5: 138,116,110 (GRCm39) probably benign Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60,899,022 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5503:Dapk1 UTSW 13 60,873,126 (GRCm39) missense probably benign 0.15
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6553:Dapk1 UTSW 13 60,908,975 (GRCm39) missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7822:Dapk1 UTSW 13 60,873,715 (GRCm39) missense probably benign 0.05
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9301:Dapk1 UTSW 13 60,866,125 (GRCm39) missense possibly damaging 0.92
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACTGGATATGAGGAGCAC -3'
(R):5'- CCAATAGAAGCAGCTCAGGG -3'

Sequencing Primer
(F):5'- GGGAGCATTATATTAAGTCACTGGG -3'
(R):5'- CAATAGAAGCAGCTCAGGGGAAAG -3'
Posted On 2019-10-07