Mutagenetix > Incidental Mutation

Incidental Mutation 'R7449:Slc4a10'

577539

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

MMRRC Submission

045524-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62303946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1002 (V1002A)

Ref Sequence

ENSEMBL: ENSMUSP00000108099 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

AlphaFold

Q5DTL9

Predicted Effect

probably benign
Transcript: ENSMUST00000054484
AA Change: V972A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: V972A

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102735
AA Change: V972A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: V972A

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112480
AA Change: V1002A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: V1002A

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0506:Slc4a10	UTSW	2	62250533	missense	probably benign	0.13
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1848:Slc4a10	UTSW	2	62316606	missense	probably damaging	1.00
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5223:Slc4a10	UTSW	2	62253366	missense	probably damaging	1.00
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7223:Slc4a10	UTSW	2	62268665	missense	probably damaging	0.99
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
R7905:Slc4a10	UTSW	2	62268151	missense	probably damaging	1.00
R8179:Slc4a10	UTSW	2	62243448	missense	possibly damaging	0.64
R8528:Slc4a10	UTSW	2	62296796	missense	possibly damaging	0.79
R8531:Slc4a10	UTSW	2	62267507	missense	probably damaging	1.00
R8772:Slc4a10	UTSW	2	62303940	missense	probably damaging	1.00
R9307:Slc4a10	UTSW	2	62253318	missense	probably damaging	1.00
R9531:Slc4a10	UTSW	2	62268810	missense	probably damaging	1.00
R9732:Slc4a10	UTSW	2	62304742	missense	probably damaging	0.97
U24488:Slc4a10	UTSW	2	62046658	missense	probably benign	0.05
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62211379	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62244416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGATGCAATCTACCGTCTG -3'
(R):5'- GCTACTGCATTATGGATGGCC -3'

Sequencing Primer
(F):5'- GATGCAATCTACCGTCTGTTTAATC -3'
(R):5'- CAAACAACCTTAGATGATACCAGAG -3'

Posted On

2019-10-07