Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Sin3b'

57754

Institutional Source

Beutler Lab

Gene Symbol

Sin3b

Ensembl Gene

ENSMUSG00000031622

Gene Name

transcriptional regulator, SIN3B (yeast)

Synonyms

2810430C10Rik

MMRRC Submission

038818-MU

Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0629 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

72723285-72758201 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 72753536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004494]

AlphaFold

Q62141

PDB Structure

STRUCTURE OF THE COMPLEX OF THE MAD1-SIN3B INTERACTION DOMAINS [SOLUTION NMR]
Extended SID of Mad1 bound to the PAH2 domain of mSin3B [SOLUTION NMR]
Solution structure of the first PAH domain of the mouse transcriptional repressor SIN3B [SOLUTION NMR]
Solution structure of the NRSF/REST-mSin3B PAH1 complex [SOLUTION NMR]
Solution structure of free PAH2 domain of mSin3B [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000004494

SMART Domains

Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:PAH	53	97	2.5e-19	PFAM
Pfam:PAH	173	227	4.4e-20	PFAM
Pfam:PAH	313	357	1.6e-8	PFAM
HDAC_interact	384	484	2.75e-58	SMART
low complexity region	667	688	N/A	INTRINSIC
Pfam:Sin3a_C	712	1011	7.2e-81	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212677

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Sin3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Sin3b	APN	8	72757000	missense	probably benign	0.22
IGL01107:Sin3b	APN	8	72731105	missense	possibly damaging	0.74
IGL01114:Sin3b	APN	8	72744505	missense	probably benign	0.06
IGL01603:Sin3b	APN	8	72750064	missense	probably damaging	1.00
IGL01763:Sin3b	APN	8	72746608	missense	probably damaging	1.00
IGL02078:Sin3b	APN	8	72753580	missense	possibly damaging	0.49
IGL02572:Sin3b	APN	8	72744481	missense	probably benign	0.15
IGL02732:Sin3b	APN	8	72733453	missense	possibly damaging	0.72
IGL02831:Sin3b	APN	8	72744562	missense	probably damaging	1.00
IGL03064:Sin3b	APN	8	72757058	unclassified	probably benign
IGL03107:Sin3b	APN	8	72753585	missense	probably damaging	0.99
IGL03142:Sin3b	APN	8	72744568	missense	probably damaging	1.00
3-1:Sin3b	UTSW	8	72753209	missense	possibly damaging	0.95
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0226:Sin3b	UTSW	8	72744508	missense	probably benign	0.44
R1486:Sin3b	UTSW	8	72750513	missense	probably benign	0.00
R1524:Sin3b	UTSW	8	72753287	missense	probably benign	0.05
R1653:Sin3b	UTSW	8	72741519	missense	probably benign	0.30
R2144:Sin3b	UTSW	8	72731265	missense	probably damaging	1.00
R2180:Sin3b	UTSW	8	72753295	nonsense	probably null
R2271:Sin3b	UTSW	8	72733419	missense	probably benign	0.11
R2353:Sin3b	UTSW	8	72724152	critical splice donor site	probably null
R3945:Sin3b	UTSW	8	72733439	missense	possibly damaging	0.88
R4412:Sin3b	UTSW	8	72739779	missense	probably benign	0.16
R4564:Sin3b	UTSW	8	72753581	missense	probably damaging	1.00
R4782:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4799:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4863:Sin3b	UTSW	8	72744948	missense	possibly damaging	0.91
R5011:Sin3b	UTSW	8	72744556	missense	probably benign	0.39
R5237:Sin3b	UTSW	8	72733343	critical splice acceptor site	probably null
R5325:Sin3b	UTSW	8	72750526	missense	probably damaging	1.00
R5725:Sin3b	UTSW	8	72725692	critical splice donor site	probably null
R5927:Sin3b	UTSW	8	72749878	missense	probably benign	0.00
R5945:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97
R6492:Sin3b	UTSW	8	72733490	critical splice donor site	probably null
R7092:Sin3b	UTSW	8	72747870	critical splice donor site	probably null
R7106:Sin3b	UTSW	8	72724137	missense	possibly damaging	0.90
R7258:Sin3b	UTSW	8	72750208	missense	probably benign	0.00
R7472:Sin3b	UTSW	8	72753225	missense	probably damaging	1.00
R7475:Sin3b	UTSW	8	72749872	missense	possibly damaging	0.47
R7491:Sin3b	UTSW	8	72746441	missense	probably damaging	1.00
R7636:Sin3b	UTSW	8	72747734	nonsense	probably null
R8063:Sin3b	UTSW	8	72725541	missense	probably damaging	1.00
R8354:Sin3b	UTSW	8	72741480	missense	probably benign
R8454:Sin3b	UTSW	8	72741480	missense	probably benign
R8711:Sin3b	UTSW	8	72723398	missense	probably damaging	0.97
R8719:Sin3b	UTSW	8	72723511	missense	unknown
R8807:Sin3b	UTSW	8	72750080	missense	probably benign	0.00
R8857:Sin3b	UTSW	8	72756895	missense	probably benign
R8924:Sin3b	UTSW	8	72746503	missense	probably benign	0.05
R9035:Sin3b	UTSW	8	72723464	missense	unknown
R9127:Sin3b	UTSW	8	72733406	missense	possibly damaging	0.70
R9272:Sin3b	UTSW	8	72744540	missense	probably benign	0.02
R9455:Sin3b	UTSW	8	72724053	missense	possibly damaging	0.56
R9641:Sin3b	UTSW	8	72750559	missense	probably damaging	1.00
X0017:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTCCTCCAGATGTGTTCGTGCAG -3'
(R):5'- ATCAGCACAGTTAGGGACGTGACC -3'

Sequencing Primer
(F):5'- ACTGCTTCAAGGTGAGACATTG -3'
(R):5'- GACGTGACCAGGACTGTG -3'

Posted On

2013-07-11