Incidental Mutation 'R0629:Sin3b'
ID57754
Institutional Source Beutler Lab
Gene Symbol Sin3b
Ensembl Gene ENSMUSG00000031622
Gene Nametranscriptional regulator, SIN3B (yeast)
Synonyms2810430C10Rik
MMRRC Submission 038818-MU
Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0629 (G1)
Quality Score211
Status Validated
Chromosome8
Chromosomal Location72723285-72758201 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 72753536 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494]
PDB Structure
STRUCTURE OF THE COMPLEX OF THE MAD1-SIN3B INTERACTION DOMAINS [SOLUTION NMR]
Extended SID of Mad1 bound to the PAH2 domain of mSin3B [SOLUTION NMR]
Solution structure of the first PAH domain of the mouse transcriptional repressor SIN3B [SOLUTION NMR]
Solution structure of the NRSF/REST-mSin3B PAH1 complex [SOLUTION NMR]
Solution structure of free PAH2 domain of mSin3B [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000004494
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Sin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Sin3b APN 8 72757000 missense probably benign 0.22
IGL01107:Sin3b APN 8 72731105 missense possibly damaging 0.74
IGL01114:Sin3b APN 8 72744505 missense probably benign 0.06
IGL01603:Sin3b APN 8 72750064 missense probably damaging 1.00
IGL01763:Sin3b APN 8 72746608 missense probably damaging 1.00
IGL02078:Sin3b APN 8 72753580 missense possibly damaging 0.49
IGL02572:Sin3b APN 8 72744481 missense probably benign 0.15
IGL02732:Sin3b APN 8 72733453 missense possibly damaging 0.72
IGL02831:Sin3b APN 8 72744562 missense probably damaging 1.00
IGL03064:Sin3b APN 8 72757058 unclassified probably benign
IGL03107:Sin3b APN 8 72753585 missense probably damaging 0.99
IGL03142:Sin3b APN 8 72744568 missense probably damaging 1.00
3-1:Sin3b UTSW 8 72753209 missense possibly damaging 0.95
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0226:Sin3b UTSW 8 72744508 missense probably benign 0.44
R1486:Sin3b UTSW 8 72750513 missense probably benign 0.00
R1524:Sin3b UTSW 8 72753287 missense probably benign 0.05
R1653:Sin3b UTSW 8 72741519 missense probably benign 0.30
R2144:Sin3b UTSW 8 72731265 missense probably damaging 1.00
R2180:Sin3b UTSW 8 72753295 nonsense probably null
R2271:Sin3b UTSW 8 72733419 missense probably benign 0.11
R2353:Sin3b UTSW 8 72724152 critical splice donor site probably null
R3945:Sin3b UTSW 8 72733439 missense possibly damaging 0.88
R4412:Sin3b UTSW 8 72739779 missense probably benign 0.16
R4564:Sin3b UTSW 8 72753581 missense probably damaging 1.00
R4782:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4799:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4863:Sin3b UTSW 8 72744948 missense possibly damaging 0.91
R5011:Sin3b UTSW 8 72744556 missense probably benign 0.39
R5237:Sin3b UTSW 8 72733343 critical splice acceptor site probably null
R5325:Sin3b UTSW 8 72750526 missense probably damaging 1.00
R5725:Sin3b UTSW 8 72725692 critical splice donor site probably null
R5927:Sin3b UTSW 8 72749878 missense probably benign 0.00
R5945:Sin3b UTSW 8 72731165 missense probably damaging 0.97
R6492:Sin3b UTSW 8 72733490 critical splice donor site probably null
R7092:Sin3b UTSW 8 72747870 critical splice donor site probably null
R7106:Sin3b UTSW 8 72724137 missense possibly damaging 0.90
R7258:Sin3b UTSW 8 72750208 missense probably benign 0.00
R7472:Sin3b UTSW 8 72753225 missense probably damaging 1.00
R7475:Sin3b UTSW 8 72749872 missense possibly damaging 0.47
R7491:Sin3b UTSW 8 72746441 missense probably damaging 1.00
R7636:Sin3b UTSW 8 72747734 nonsense probably null
X0017:Sin3b UTSW 8 72731165 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTCCTCCAGATGTGTTCGTGCAG -3'
(R):5'- ATCAGCACAGTTAGGGACGTGACC -3'

Sequencing Primer
(F):5'- ACTGCTTCAAGGTGAGACATTG -3'
(R):5'- GACGTGACCAGGACTGTG -3'
Posted On2013-07-11