Mutagenetix > Incidental Mutation

Incidental Mutation 'R7449:Cnga1'

577546

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

045524-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.250) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72605304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 289 (I289T)

Ref Sequence

ENSEMBL: ENSMUSP00000084464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]

AlphaFold

P29974

Predicted Effect

probably benign
Transcript: ENSMUST00000087213
AA Change: I289T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: I289T

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000169997
AA Change: I289T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: I289T

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000201463
AA Change: I289T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: I289T

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
tintoretto	UTSW	5	72609500	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
R7922:Cnga1	UTSW	5	72604882	missense	possibly damaging	0.81
R7938:Cnga1	UTSW	5	72604254	missense	probably benign	0.27
R7994:Cnga1	UTSW	5	72604660	missense	probably damaging	1.00
R8249:Cnga1	UTSW	5	72605394	missense	probably benign	0.02
R8690:Cnga1	UTSW	5	72604492	missense	probably benign	0.15
R9689:Cnga1	UTSW	5	72604827	missense	probably benign	0.10
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00
Z1177:Cnga1	UTSW	5	72605530	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGTTGTCAAAGTCAAAGTAGACC -3'
(R):5'- GTTACCTGGAACAAGGGCTG -3'

Sequencing Primer
(F):5'- TCAAAGTAGACCAATAAAGGCTGTAG -3'
(R):5'- CTGGAACAAGGGCTGCTAGTG -3'

Posted On

2019-10-07