Incidental Mutation 'R7449:Pus1'
ID577549
Institutional Source Beutler Lab
Gene Symbol Pus1
Ensembl Gene ENSMUSG00000029507
Gene Namepseudouridine synthase 1
SynonymsMPUS1, A730013B20Rik, mPus1p
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110773667-110780659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110774586 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 405 (L405P)
Ref Sequence ENSEMBL: ENSMUSP00000083844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031481] [ENSMUST00000031483] [ENSMUST00000041558] [ENSMUST00000086643] [ENSMUST00000112426] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000136483] [ENSMUST00000146458] [ENSMUST00000149208] [ENSMUST00000170468]
Predicted Effect probably damaging
Transcript: ENSMUST00000031481
AA Change: L357P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031481
Gene: ENSMUSG00000029507
AA Change: L357P

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031483
AA Change: L387P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031483
Gene: ENSMUSG00000029507
AA Change: L387P

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 191 1.3e-11 PFAM
Pfam:PseudoU_synth_1 231 337 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041558
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086643
AA Change: L405P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083844
Gene: ENSMUSG00000029507
AA Change: L405P

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 208 1.2e-7 PFAM
Pfam:PseudoU_synth_1 249 355 8.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112426
AA Change: L311P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108045
Gene: ENSMUSG00000029507
AA Change: L311P

DomainStartEndE-ValueType
SCOP:d1dj0a1 48 116 1e-12 SMART
Pfam:PseudoU_synth_1 155 261 5.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112433
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112436
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136483
SMART Domains Protein: ENSMUSP00000115143
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 147 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146458
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149208
SMART Domains Protein: ENSMUSP00000115468
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
PDB:4J37|A 37 162 3e-57 PDB
SCOP:d1dj0a1 48 162 3e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170468
AA Change: L357P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130814
Gene: ENSMUSG00000029507
AA Change: L357P

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slow postnatal weight gain, impaired exercise endurance, and alterations in muscle metabolism related to mitochondrial content and oxidative capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Pus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Pus1 UTSW 5 110774854 missense probably benign 0.09
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0486:Pus1 UTSW 5 110779730 missense probably damaging 1.00
R1922:Pus1 UTSW 5 110777639 missense probably damaging 1.00
R2305:Pus1 UTSW 5 110774960 missense probably benign 0.08
R4528:Pus1 UTSW 5 110774730 missense probably damaging 1.00
R4609:Pus1 UTSW 5 110780318 start codon destroyed probably null 0.06
R4846:Pus1 UTSW 5 110779930 intron probably benign
R5720:Pus1 UTSW 5 110777718 missense probably damaging 1.00
R6207:Pus1 UTSW 5 110777714 missense probably benign 0.12
R7123:Pus1 UTSW 5 110773932 makesense probably null
R7827:Pus1 UTSW 5 110779716 missense probably damaging 1.00
RF016:Pus1 UTSW 5 110776558 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCCATGAGTAAACCTTGC -3'
(R):5'- TAGTCCTGGAGAGGGTTCAC -3'

Sequencing Primer
(F):5'- AGCAGGAGGTAGCCCAC -3'
(R):5'- CCTGGAGAGGGTTCACTTTGAAAAG -3'
Posted On2019-10-07