Incidental Mutation 'R7449:Dysf'
ID 577552
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Name dysferlin
Synonyms 2310004N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 84008590-84211060 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84137380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1217 (L1217P)
Ref Sequence ENSEMBL: ENSMUSP00000109449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]
AlphaFold Q9ESD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000081904
AA Change: L1248P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: L1248P

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089595
AA Change: L1231P

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: L1231P

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113818
AA Change: L1217P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: L1217P

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113821
AA Change: L1230P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: L1230P

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113823
AA Change: L1247P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: L1247P

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153860
AA Change: L1230P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: L1230P

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168387
AA Change: L1238P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: L1238P

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203695
AA Change: L1262P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: L1262P

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203803
AA Change: L1261P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: L1261P

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204354
AA Change: L1217P

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: L1217P

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204591
AA Change: L1247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: L1247P

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204987
AA Change: L1231P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: L1231P

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84108099 missense probably damaging 1.00
IGL00340:Dysf APN 6 84141951 missense probably benign 0.02
IGL00429:Dysf APN 6 84189844 missense probably damaging 1.00
IGL00465:Dysf APN 6 84199848 critical splice donor site probably null
IGL00800:Dysf APN 6 84149998 missense probably damaging 1.00
IGL01069:Dysf APN 6 84199785 missense possibly damaging 0.94
IGL01094:Dysf APN 6 84194386 missense probably damaging 1.00
IGL01420:Dysf APN 6 84149759 nonsense probably null
IGL01649:Dysf APN 6 84199839 missense probably damaging 1.00
IGL01923:Dysf APN 6 84210829 makesense probably null
IGL01991:Dysf APN 6 84113618 missense probably damaging 1.00
IGL01999:Dysf APN 6 84113618 missense probably damaging 1.00
IGL02002:Dysf APN 6 84210787 splice site probably benign
IGL02136:Dysf APN 6 84108167 missense probably benign 0.43
IGL02318:Dysf APN 6 84186464 missense possibly damaging 0.50
IGL02378:Dysf APN 6 84111905 missense probably damaging 1.00
IGL02404:Dysf APN 6 84116061 missense probably damaging 1.00
IGL02416:Dysf APN 6 84192914 missense possibly damaging 0.92
IGL02535:Dysf APN 6 84149697 missense possibly damaging 0.45
IGL02553:Dysf APN 6 84130127 missense possibly damaging 0.95
IGL02559:Dysf APN 6 84067446 splice site probably benign
IGL02563:Dysf APN 6 84186516 splice site probably benign
IGL02647:Dysf APN 6 84137373 missense probably damaging 1.00
IGL02820:Dysf APN 6 84100205 missense probably damaging 0.99
IGL02858:Dysf APN 6 84099489 missense probably benign 0.01
IGL02860:Dysf APN 6 84190898 critical splice donor site probably null
IGL02861:Dysf APN 6 84039537 missense probably damaging 0.99
IGL03008:Dysf APN 6 84073894 missense probably benign 0.01
IGL03023:Dysf APN 6 84193007 missense probably damaging 1.00
IGL03074:Dysf APN 6 84188226 missense probably benign 0.25
IGL03342:Dysf APN 6 84190872 missense probably benign
PIT4305001:Dysf UTSW 6 84100234 nonsense probably null
R0067:Dysf UTSW 6 84063331 missense possibly damaging 0.58
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0124:Dysf UTSW 6 84065102 splice site probably benign
R0219:Dysf UTSW 6 84129461 splice site probably benign
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0426:Dysf UTSW 6 84149757 missense probably damaging 1.00
R0455:Dysf UTSW 6 84140667 missense probably benign 0.29
R0482:Dysf UTSW 6 84152405 missense probably benign 0.03
R0545:Dysf UTSW 6 84099461 missense probably damaging 0.99
R0625:Dysf UTSW 6 84111987 splice site probably null
R0676:Dysf UTSW 6 84113336 missense probably benign 0.07
R0699:Dysf UTSW 6 84190846 missense probably benign 0.00
R1165:Dysf UTSW 6 84067069 missense probably damaging 0.98
R1455:Dysf UTSW 6 84113386 missense probably benign 0.01
R1582:Dysf UTSW 6 84097767 missense probably damaging 1.00
R1584:Dysf UTSW 6 84067047 missense probably benign 0.04
R1605:Dysf UTSW 6 84106941 missense probably damaging 0.96
R1674:Dysf UTSW 6 84179715 missense probably benign 0.01
R1739:Dysf UTSW 6 84112235 critical splice donor site probably null
R1765:Dysf UTSW 6 84190902 splice site probably null
R1813:Dysf UTSW 6 84151924 missense possibly damaging 0.83
R1900:Dysf UTSW 6 84039567 missense probably damaging 0.97
R1960:Dysf UTSW 6 84073903 missense probably benign 0.12
R2216:Dysf UTSW 6 84207245 splice site probably null
R2242:Dysf UTSW 6 84186509 critical splice donor site probably null
R2243:Dysf UTSW 6 84186509 critical splice donor site probably null
R2245:Dysf UTSW 6 84186509 critical splice donor site probably null
R2246:Dysf UTSW 6 84186509 critical splice donor site probably null
R2280:Dysf UTSW 6 84064494 missense probably damaging 0.99
R2374:Dysf UTSW 6 84097729 missense probably damaging 1.00
R2403:Dysf UTSW 6 84039567 missense possibly damaging 0.84
R2763:Dysf UTSW 6 84106932 missense probably benign 0.00
R2895:Dysf UTSW 6 84186509 critical splice donor site probably null
R2916:Dysf UTSW 6 84186509 critical splice donor site probably null
R2918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3402:Dysf UTSW 6 84186509 critical splice donor site probably null
R3403:Dysf UTSW 6 84186509 critical splice donor site probably null
R3434:Dysf UTSW 6 84070888 missense probably benign 0.00
R3772:Dysf UTSW 6 84152351 missense possibly damaging 0.63
R3781:Dysf UTSW 6 84186509 critical splice donor site probably null
R3789:Dysf UTSW 6 84186509 critical splice donor site probably null
R3822:Dysf UTSW 6 84207088 splice site probably benign
R3918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3919:Dysf UTSW 6 84186509 critical splice donor site probably null
R3939:Dysf UTSW 6 84186509 critical splice donor site probably null
R3942:Dysf UTSW 6 84186509 critical splice donor site probably null
R4177:Dysf UTSW 6 84067031 nonsense probably null
R4179:Dysf UTSW 6 84186509 critical splice donor site probably null
R4180:Dysf UTSW 6 84186509 critical splice donor site probably null
R4299:Dysf UTSW 6 84068077 missense possibly damaging 0.78
R4419:Dysf UTSW 6 84207242 critical splice donor site probably null
R4446:Dysf UTSW 6 84205872 missense probably damaging 1.00
R4577:Dysf UTSW 6 84137326 missense probably damaging 1.00
R4680:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4708:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4709:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4710:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4725:Dysf UTSW 6 84097756 missense probably damaging 1.00
R4742:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4743:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4749:Dysf UTSW 6 84067008 missense probably damaging 1.00
R4787:Dysf UTSW 6 84203328 nonsense probably null
R4850:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4868:Dysf UTSW 6 84179693 missense probably damaging 1.00
R4871:Dysf UTSW 6 84067023 missense possibly damaging 0.93
R4951:Dysf UTSW 6 84114120 critical splice donor site probably null
R4952:Dysf UTSW 6 84149986 missense possibly damaging 0.79
R5009:Dysf UTSW 6 84151986 missense probably damaging 1.00
R5072:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5073:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5074:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5252:Dysf UTSW 6 84186468 missense probably damaging 0.98
R5260:Dysf UTSW 6 84150034 missense probably damaging 1.00
R5447:Dysf UTSW 6 84195263 missense probably damaging 0.98
R5501:Dysf UTSW 6 84087818 missense probably damaging 0.99
R5533:Dysf UTSW 6 84186471 missense probably damaging 0.99
R5611:Dysf UTSW 6 84064878 missense probably damaging 0.98
R5618:Dysf UTSW 6 84106824 missense probably benign 0.03
R5884:Dysf UTSW 6 84186081 missense probably damaging 1.00
R5927:Dysf UTSW 6 84207212 missense probably damaging 1.00
R6045:Dysf UTSW 6 84114072 missense probably damaging 0.99
R6056:Dysf UTSW 6 84106862 missense probably benign
R6084:Dysf UTSW 6 84019604 missense probably damaging 0.98
R6084:Dysf UTSW 6 84112119 missense probably damaging 1.00
R6146:Dysf UTSW 6 84203199 missense probably damaging 0.96
R6220:Dysf UTSW 6 84149745 missense probably damaging 0.97
R6232:Dysf UTSW 6 84098253 missense probably benign 0.26
R6247:Dysf UTSW 6 84066999 missense probably damaging 1.00
R6298:Dysf UTSW 6 84107136 splice site probably null
R6306:Dysf UTSW 6 84137266 missense possibly damaging 0.91
R6377:Dysf UTSW 6 84008963 missense probably benign
R6415:Dysf UTSW 6 84140042 missense probably damaging 1.00
R6444:Dysf UTSW 6 84190840 missense probably benign 0.36
R6470:Dysf UTSW 6 84066944 missense possibly damaging 0.93
R6504:Dysf UTSW 6 84008925 missense probably benign 0.03
R6557:Dysf UTSW 6 84186384 missense probably damaging 0.99
R6665:Dysf UTSW 6 84130116 missense probably benign
R6701:Dysf UTSW 6 84112190 missense probably damaging 1.00
R6776:Dysf UTSW 6 84064894 missense possibly damaging 0.88
R6909:Dysf UTSW 6 84192938 missense probably damaging 1.00
R7007:Dysf UTSW 6 84113980 missense probably damaging 1.00
R7013:Dysf UTSW 6 84137358 missense probably damaging 1.00
R7035:Dysf UTSW 6 84186392 missense probably benign 0.02
R7094:Dysf UTSW 6 84100202 missense probably benign 0.43
R7124:Dysf UTSW 6 84190901 splice site probably null
R7156:Dysf UTSW 6 84087876 critical splice donor site probably null
R7261:Dysf UTSW 6 84193010 missense probably damaging 0.98
R7296:Dysf UTSW 6 84106898 missense probably benign 0.33
R7356:Dysf UTSW 6 84067461 missense probably damaging 1.00
R7359:Dysf UTSW 6 84195324 splice site probably null
R7384:Dysf UTSW 6 84114105 missense probably benign 0.17
R7409:Dysf UTSW 6 84149682 missense probably benign 0.00
R7476:Dysf UTSW 6 84064896 missense probably benign 0.08
R7496:Dysf UTSW 6 84067478 missense probably benign 0.43
R7573:Dysf UTSW 6 84130122 missense possibly damaging 0.59
R7616:Dysf UTSW 6 84101963 missense probably benign 0.01
R7684:Dysf UTSW 6 84100135 missense probably benign 0.00
R7808:Dysf UTSW 6 84070929 missense possibly damaging 0.86
R7836:Dysf UTSW 6 84137398 missense probably damaging 1.00
R7868:Dysf UTSW 6 84114099 missense probably benign 0.00
R7873:Dysf UTSW 6 84083765 missense probably benign
R7956:Dysf UTSW 6 84008996 missense probably benign 0.01
R8130:Dysf UTSW 6 84137376 missense probably damaging 0.97
R8357:Dysf UTSW 6 84188245 missense probably benign 0.01
R8383:Dysf UTSW 6 84019583 missense probably damaging 1.00
R8457:Dysf UTSW 6 84188245 missense probably benign 0.01
R8693:Dysf UTSW 6 84111970 missense probably damaging 1.00
R8738:Dysf UTSW 6 84194371 missense probably damaging 1.00
R8808:Dysf UTSW 6 84019484 start gained probably benign
R8836:Dysf UTSW 6 84116123 missense probably damaging 1.00
R8915:Dysf UTSW 6 84179754 missense probably benign
R8959:Dysf UTSW 6 84101963 missense probably benign 0.01
R9091:Dysf UTSW 6 84100234 nonsense probably null
R9095:Dysf UTSW 6 84179684 missense probably benign 0.01
R9162:Dysf UTSW 6 84112233 missense probably damaging 1.00
R9164:Dysf UTSW 6 84203326 missense probably damaging 1.00
R9166:Dysf UTSW 6 84149977 missense probably damaging 1.00
R9173:Dysf UTSW 6 84194397 missense probably benign 0.10
R9191:Dysf UTSW 6 84068066 missense probably benign 0.43
R9270:Dysf UTSW 6 84100234 nonsense probably null
R9328:Dysf UTSW 6 84073913 missense probably damaging 1.00
R9470:Dysf UTSW 6 84113370 missense possibly damaging 0.59
R9509:Dysf UTSW 6 84210797 missense probably damaging 0.98
R9511:Dysf UTSW 6 84113668 missense probably damaging 1.00
R9526:Dysf UTSW 6 84151903 missense probably damaging 0.99
R9751:Dysf UTSW 6 84186468 missense probably damaging 0.98
X0063:Dysf UTSW 6 84063354 missense probably damaging 0.97
X0066:Dysf UTSW 6 84114102 missense possibly damaging 0.77
Z1176:Dysf UTSW 6 84072685 missense probably damaging 1.00
Z1177:Dysf UTSW 6 84064523 missense probably benign
Z1177:Dysf UTSW 6 84087817 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGGCTGTGGAACTCCTGAAC -3'
(R):5'- TAGTCATGTCTTCCAAGGGTCATG -3'

Sequencing Primer
(F):5'- ACCACAGCTGAGTCTTGC -3'
(R):5'- GACTTGGAGACCCAAAAC -3'
Posted On 2019-10-07