Mutagenetix > Incidental Mutations

Incidental Mutation 'R0629:Ttc13'

57756

Institutional Source

Beutler Lab

Gene Symbol

Ttc13

Ensembl Gene

ENSMUSG00000037300

Gene Name

tetratricopeptide repeat domain 13

Synonyms

MGC:28881

MMRRC Submission

038818-MU

Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124671332-124721983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124674366 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 624 (S624T)

Ref Sequence

ENSEMBL: ENSMUSP00000156040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041614
AA Change: S625T

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: S625T

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:TPR_11	153	204	3e-8	PFAM
Pfam:TPR_19	154	213	5.1e-8	PFAM
Pfam:TPR_1	173	206	6.1e-10	PFAM
Pfam:TPR_2	173	206	1.2e-7	PFAM
Pfam:TPR_8	173	206	5.2e-8	PFAM
Pfam:TPR_16	177	241	6.5e-11	PFAM
Pfam:TPR_9	179	249	3.5e-6	PFAM
Pfam:TPR_11	204	272	2.2e-8	PFAM
Pfam:TPR_1	207	240	3.3e-5	PFAM
Pfam:TPR_2	207	240	1.9e-5	PFAM
Blast:UTG	692	755	4e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000117624
AA Change: S647T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: S647T

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	161	2e-13	BLAST
TPR	162	194	1.08e1	SMART
TPR	195	228	2.24e-7	SMART
TPR	229	262	3.67e-3	SMART
Blast:UTG	714	777	4e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000118134
AA Change: S701T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: S701T

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Blast:TPR	128	156	4e-10	BLAST
TPR	181	214	5.56e-3	SMART
TPR	215	248	1.17e-1	SMART
TPR	249	282	2.24e-7	SMART
TPR	283	316	3.67e-3	SMART
Blast:UTG	768	831	1e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126674

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130344

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140350

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214828
AA Change: S753T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231984
AA Change: S624T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.1038

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Ttc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Ttc13	APN	8	124688847	splice site	probably benign
IGL01086:Ttc13	APN	8	124675346	missense	probably damaging	0.98
IGL01411:Ttc13	APN	8	124683285	missense	probably damaging	1.00
IGL01511:Ttc13	APN	8	124676371	missense	probably damaging	1.00
IGL01610:Ttc13	APN	8	124676344	missense	probably damaging	1.00
IGL01626:Ttc13	APN	8	124673738	splice site	probably benign
IGL01967:Ttc13	APN	8	124712647	missense	probably damaging	0.99
IGL01995:Ttc13	APN	8	124688882	missense	probably damaging	1.00
IGL02456:Ttc13	APN	8	124690361	critical splice acceptor site	probably null
IGL02816:Ttc13	APN	8	124712676	missense	possibly damaging	0.89
3-1:Ttc13	UTSW	8	124679009	missense	possibly damaging	0.81
LCD18:Ttc13	UTSW	8	124675866	intron	probably benign
R0126:Ttc13	UTSW	8	124683291	missense	probably damaging	0.99
R0391:Ttc13	UTSW	8	124674401	missense	probably damaging	1.00
R0602:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0638:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R0714:Ttc13	UTSW	8	124674366	missense	probably damaging	0.99
R1981:Ttc13	UTSW	8	124714187	critical splice donor site	probably null
R2051:Ttc13	UTSW	8	124672211	splice site	probably null
R2324:Ttc13	UTSW	8	124679057	missense	probably damaging	1.00
R2404:Ttc13	UTSW	8	124678997	splice site	probably benign
R2571:Ttc13	UTSW	8	124683799	missense	probably damaging	1.00
R3110:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R3112:Ttc13	UTSW	8	124683834	missense	possibly damaging	0.90
R4560:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4562:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4563:Ttc13	UTSW	8	124675277	missense	probably damaging	1.00
R4565:Ttc13	UTSW	8	124682087	missense	probably damaging	1.00
R4855:Ttc13	UTSW	8	124674435	missense	probably damaging	1.00
R4998:Ttc13	UTSW	8	124680056	missense	probably damaging	1.00
R5137:Ttc13	UTSW	8	124694935	nonsense	probably null
R5397:Ttc13	UTSW	8	124675263	missense	possibly damaging	0.94
R5619:Ttc13	UTSW	8	124679944	intron	probably benign
R5966:Ttc13	UTSW	8	124682220	intron	probably benign
R6092:Ttc13	UTSW	8	124679033	missense	probably benign	0.36
R6321:Ttc13	UTSW	8	124683191	missense	probably damaging	1.00
R6439:Ttc13	UTSW	8	124673482	missense	probably benign	0.02
R6737:Ttc13	UTSW	8	124682161	critical splice acceptor site	probably null
R6804:Ttc13	UTSW	8	124699687	missense	probably damaging	1.00
R6967:Ttc13	UTSW	8	124688618	missense	probably benign	0.17
R7542:Ttc13	UTSW	8	124675103	intron	probably null
X0027:Ttc13	UTSW	8	124673589	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCTTCAGAGAGCAGCACACGG -3'
(R):5'- TTCTAACTAAGCACGCCAGCCCTG -3'

Sequencing Primer
(F):5'- acccacctgcctgtctc -3'
(R):5'- CCCTGAGAGAGGGCAGC -3'

Posted On

2013-07-11