Mutagenetix > Incidental Mutations

Incidental Mutation 'R7449:Atp7b'

577567

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.768) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21992785-22060305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22011849 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 833 (I833F)

Ref Sequence

ENSEMBL: ENSMUSP00000006742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006742
AA Change: I833F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: I833F

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110738
AA Change: I718F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: I718F

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22011098	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22027527	splice site	probably null
IGL01600:Atp7b	APN	8	22027525	splice site	probably null
IGL01713:Atp7b	APN	8	22028573	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	21994828	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22011781	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	21994770	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22028085	missense	probably benign
IGL02573:Atp7b	APN	8	22022470	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	21994776	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22028438	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22022477	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22018143	missense	probably damaging	1.00
daffodil	UTSW	8	21998266	missense	probably damaging	1.00
menace	UTSW	8	22022365	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	21994656	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22011073	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22059995	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0130:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22028451	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	21995659	splice site	probably null
R0856:Atp7b	UTSW	8	21997631	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22027826	missense	probably benign
R0989:Atp7b	UTSW	8	22028694	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22011785	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	21997358	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22027673	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22028724	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22006387	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22011651	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22027980	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22011077	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22013584	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22014547	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22020832	missense	probably benign	0.20
R2475:Atp7b	UTSW	8	21994776	missense	possibly damaging	0.88
R2906:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3688:Atp7b	UTSW	8	22004230	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22020864	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22028601	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22020885	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22027698	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22015869	splice site	probably null
R5038:Atp7b	UTSW	8	22028456	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22014554	missense	probably benign
R5467:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22059970	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22012739	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22028714	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22018128	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22027863	missense	probably benign
R5941:Atp7b	UTSW	8	21997496	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22020825	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22015927	nonsense	probably null
R6290:Atp7b	UTSW	8	22020820	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22020755	splice site	probably null
R6647:Atp7b	UTSW	8	22028478	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22004375	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22022365	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22028690	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	21994812	missense	probably benign
R6965:Atp7b	UTSW	8	22028085	missense	probably benign
R7203:Atp7b	UTSW	8	21997335	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22022378	nonsense	probably null
R7344:Atp7b	UTSW	8	21997499	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22022315	missense	probably benign	0.01
R7451:Atp7b	UTSW	8	22014684	nonsense	probably null
R7607:Atp7b	UTSW	8	22011506	missense	probably damaging	1.00
R8140:Atp7b	UTSW	8	22028560	missense	probably damaging	1.00
R8160:Atp7b	UTSW	8	21997559	missense	probably damaging	0.98
R8349:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22028471	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
Z1176:Atp7b	UTSW	8	22028714	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	21994877	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTCCCAGGTTTCTTAGTGACAG -3'
(R):5'- GCAAGGTTGGTTATGTCTGCTAATC -3'

Sequencing Primer
(F):5'- ATGGCCTCTCCTAGGGAAGAGAC -3'
(R):5'- TGGTTATGTCTGCTAATCTAGAACTC -3'

Posted On

2019-10-07