Incidental Mutation 'R0629:Cdc37'
ID57757
Institutional Source Beutler Lab
Gene Symbol Cdc37
Ensembl Gene ENSMUSG00000019471
Gene Namecell division cycle 37
Synonymsp50Cdc37
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0629 (G1)
Quality Score153
Status Validated
Chromosome9
Chromosomal Location21133222-21149982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21140768 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 325 (M325R)
Ref Sequence ENSEMBL: ENSMUSP00000019615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019615] [ENSMUST00000215296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019615
AA Change: M325R

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019615
Gene: ENSMUSG00000019471
AA Change: M325R

DomainStartEndE-ValueType
CDC37_N 1 128 1.07e-69 SMART
CDC37_M 121 283 4.37e-84 SMART
CDC37_C 287 379 1.25e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215866
Meta Mutation Damage Score 0.7990 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Cdc 37, a cell division cycle control protein of Sacchromyces cerevisiae. This protein is a molecular chaperone with specific function in cell signal transduction. It has been shown to form complex with Hsp90 and a variety of protein kinases including CDK4, CDK6, SRC, RAF-1, MOK, as well as eIF2 alpha kinases. It is thought to play a critical role in directing Hsp90 to its target kinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Cdc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Cdc37 APN 9 21143113 missense probably benign 0.00
IGL02448:Cdc37 APN 9 21139851 missense possibly damaging 0.55
IGL02547:Cdc37 APN 9 21139966 unclassified probably benign
R0137:Cdc37 UTSW 9 21142130 missense possibly damaging 0.74
R0195:Cdc37 UTSW 9 21142280 missense probably benign 0.01
R0523:Cdc37 UTSW 9 21142996 missense probably damaging 1.00
R0611:Cdc37 UTSW 9 21142241 missense probably damaging 1.00
R0755:Cdc37 UTSW 9 21139864 missense probably damaging 1.00
R1512:Cdc37 UTSW 9 21142416 splice site probably benign
R2127:Cdc37 UTSW 9 21149847 missense probably damaging 1.00
R2238:Cdc37 UTSW 9 21142533 nonsense probably null
R2239:Cdc37 UTSW 9 21142533 nonsense probably null
R3031:Cdc37 UTSW 9 21143191 missense possibly damaging 0.88
R5068:Cdc37 UTSW 9 21149803 missense probably damaging 0.98
R5169:Cdc37 UTSW 9 21141117 missense probably benign 0.00
R5308:Cdc37 UTSW 9 21140764 missense probably benign 0.00
R5333:Cdc37 UTSW 9 21143161 missense possibly damaging 0.69
R5595:Cdc37 UTSW 9 21143213 missense probably damaging 1.00
R7040:Cdc37 UTSW 9 21142223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGTTCTCAGACAGGGTCTCAC -3'
(R):5'- CACCAGTACATGGAGGGCTTCAAG -3'

Sequencing Primer
(F):5'- ctgaattgctctggctcatcttaac -3'
(R):5'- CTTCAAGTATGAACTGGAAGCC -3'
Posted On2013-07-11