Incidental Mutation 'R7449:Sema3f'
ID577571
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
SynonymsSema IV, Semak
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107681500-107710475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107684036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 584 (S584G)
Ref Sequence ENSEMBL: ENSMUSP00000141865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271] [ENSMUST00000192727] [ENSMUST00000192783] [ENSMUST00000193108] [ENSMUST00000194039]
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080560
AA Change: S553G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: S553G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192727
AA Change: S584G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: S584G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192783
SMART Domains Protein: ENSMUSP00000141668
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
Sema 1 276 3.6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193108
SMART Domains Protein: ENSMUSP00000141878
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 191 9.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194039
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194424
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107685522 missense probably benign 0.44
IGL01940:Sema3f APN 9 107683697 unclassified probably benign
IGL02070:Sema3f APN 9 107692241 missense probably damaging 1.00
IGL02381:Sema3f APN 9 107692395 missense probably damaging 1.00
IGL02472:Sema3f APN 9 107687736 missense probably damaging 1.00
IGL02557:Sema3f APN 9 107687212 missense probably damaging 1.00
IGL02614:Sema3f APN 9 107682511 missense probably benign 0.28
IGL02660:Sema3f APN 9 107683984 missense probably benign 0.05
R1468:Sema3f UTSW 9 107687572 unclassified probably benign
R1905:Sema3f UTSW 9 107684376 missense probably damaging 1.00
R4728:Sema3f UTSW 9 107705440 missense probably benign 0.00
R4772:Sema3f UTSW 9 107689720 nonsense probably null
R4786:Sema3f UTSW 9 107682682 missense probably benign 0.45
R4845:Sema3f UTSW 9 107685501 missense probably damaging 1.00
R5418:Sema3f UTSW 9 107692621 missense probably damaging 1.00
R5780:Sema3f UTSW 9 107682589 missense probably damaging 0.98
R5849:Sema3f UTSW 9 107682616 missense probably damaging 0.98
R5929:Sema3f UTSW 9 107692193 missense probably damaging 1.00
R6968:Sema3f UTSW 9 107691449 critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107691400 missense possibly damaging 0.91
R7526:Sema3f UTSW 9 107689728 missense probably damaging 0.96
R7559:Sema3f UTSW 9 107684578 missense possibly damaging 0.52
R7640:Sema3f UTSW 9 107683575 missense probably benign 0.20
R7771:Sema3f UTSW 9 107692426 missense possibly damaging 0.89
R7789:Sema3f UTSW 9 107705432 missense probably benign 0.00
R8058:Sema3f UTSW 9 107682601 missense probably benign 0.42
R8113:Sema3f UTSW 9 107688076 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCTCCATTGAGGTGGCTTC -3'
(R):5'- GCCAGAACCTCGGGATTCTATC -3'

Sequencing Primer
(F):5'- ATTGAGGTGGCTTCCTAATCCCAG -3'
(R):5'- GATTCTATCCAAAGCCCTGGGAG -3'
Posted On2019-10-07