Incidental Mutation 'R7449:Fam184a'
ID577573
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53698634 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 293 (E293G)
Ref Sequence ENSEMBL: ENSMUSP00000020003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000171807]
Predicted Effect probably damaging
Transcript: ENSMUST00000020003
AA Change: E293G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: E293G

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163761
AA Change: E237G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: E237G

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171807
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7979:Fam184a UTSW 10 53633706 nonsense probably null
R7980:Fam184a UTSW 10 53633706 nonsense probably null
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAAGAAACCCTAGATGGCCC -3'
(R):5'- GTTGAAGTCACAGCAGAACCAC -3'

Sequencing Primer
(F):5'- TAGATGGCCCACCTCTCAC -3'
(R):5'- GAGGCCTTGAACAACACGGTC -3'
Posted On2019-10-07