Incidental Mutation 'R7449:Txnrd1'
ID577575
Institutional Source Beutler Lab
Gene Symbol Txnrd1
Ensembl Gene ENSMUSG00000020250
Gene Namethioredoxin reductase 1
SynonymsTR1, TR, TrxR1, TR alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location82833951-82897712 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 82885233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 494 (Y494*)
Ref Sequence ENSEMBL: ENSMUSP00000151629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020484] [ENSMUST00000218694] [ENSMUST00000219368] [ENSMUST00000219442] [ENSMUST00000219962]
Predicted Effect probably null
Transcript: ENSMUST00000020484
AA Change: Y380*
SMART Domains Protein: ENSMUSP00000020484
Gene: ENSMUSG00000020250
AA Change: Y380*

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 350 9.7e-69 PFAM
Pfam:FAD_binding_2 14 69 2.6e-8 PFAM
Pfam:Pyr_redox 192 273 1.3e-18 PFAM
Pfam:Pyr_redox_dim 370 483 8.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218694
Predicted Effect probably null
Transcript: ENSMUST00000219368
AA Change: Y494*
Predicted Effect probably null
Transcript: ENSMUST00000219442
AA Change: Y380*
Predicted Effect probably null
Transcript: ENSMUST00000219962
AA Change: Y380*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide-disulfide oxidoreductases. This protein is a flavoenzyme, which uses NADPH for reduction of thioredoxins as well as other protein and nonprotein substrates, and plays a role in protection against oxidative stress. It contains a selenocysteine (Sec) residue, which is essential for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit early embryonic lethality (by E10.5) and display severe growth retardation and fail to turn. Embryos also exhibit decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Txnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txnrd1 APN 10 82875662 missense probably damaging 1.00
IGL00644:Txnrd1 APN 10 82885176 splice site probably benign
IGL01995:Txnrd1 APN 10 82877284 missense probably damaging 1.00
IGL02167:Txnrd1 APN 10 82881911 missense probably benign 0.01
IGL02368:Txnrd1 APN 10 82895974 splice site probably null
IGL02500:Txnrd1 APN 10 82879217 missense probably damaging 1.00
IGL02870:Txnrd1 APN 10 82895979 missense probably benign 0.13
IGL03188:Txnrd1 APN 10 82885046 missense possibly damaging 0.79
IGL03257:Txnrd1 APN 10 82885271 missense probably benign 0.00
F6893:Txnrd1 UTSW 10 82866989 nonsense probably null
R0092:Txnrd1 UTSW 10 82879802 missense probably damaging 1.00
R2019:Txnrd1 UTSW 10 82877373 missense probably benign 0.00
R2088:Txnrd1 UTSW 10 82883910 splice site probably benign
R2101:Txnrd1 UTSW 10 82881739 missense probably damaging 1.00
R2120:Txnrd1 UTSW 10 82887233 missense possibly damaging 0.86
R2696:Txnrd1 UTSW 10 82885282 missense probably benign 0.05
R4058:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4059:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4879:Txnrd1 UTSW 10 82881917 splice site probably null
R5582:Txnrd1 UTSW 10 82895980 missense possibly damaging 0.72
R6870:Txnrd1 UTSW 10 82873208 missense probably benign 0.45
R6965:Txnrd1 UTSW 10 82881818 missense probably benign 0.02
R7336:Txnrd1 UTSW 10 82873217 missense probably benign 0.00
R8350:Txnrd1 UTSW 10 82881925 missense probably benign 0.02
R8369:Txnrd1 UTSW 10 82874646 missense probably benign 0.01
RF019:Txnrd1 UTSW 10 82885100 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTACGCCATCGGTGACATC -3'
(R):5'- GCTGAAGCCATCTTGGTGAG -3'

Sequencing Primer
(F):5'- ATCGGTGACATCCTGGAGG -3'
(R):5'- TCCCGAGGGATCTATCTGATGC -3'
Posted On2019-10-07