Incidental Mutation 'R7449:Nid1'
ID577587
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13482051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 589 (V589G)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure
NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005532
AA Change: V589G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: V589G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R1397:Nid1 UTSW 13 13508795 missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4128:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4680:Nid1 UTSW 13 13472852 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R5868:Nid1 UTSW 13 13489157 critical splice donor site probably null
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R6761:Nid1 UTSW 13 13482035 missense probably benign 0.22
R7069:Nid1 UTSW 13 13508768 missense probably benign
R7208:Nid1 UTSW 13 13468385 missense probably benign 0.01
R7284:Nid1 UTSW 13 13489090 missense probably benign 0.01
R7434:Nid1 UTSW 13 13468464 missense probably benign
R7574:Nid1 UTSW 13 13468443 missense probably benign
R7762:Nid1 UTSW 13 13489045 missense probably damaging 1.00
R7887:Nid1 UTSW 13 13499733 missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13437831 missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13476174 missense probably damaging 0.99
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCCCTGATGCTGCTACAGG -3'
(R):5'- ATAGCGCAAGATCCTCTCCTC -3'

Sequencing Primer
(F):5'- GGCACAAACAAATGGTCCTGTTTAAG -3'
(R):5'- AAGATCCTCTCCTCCTTGTTGTACAG -3'
Posted On2019-10-07