Incidental Mutation 'R7449:Rhobtb3'
ID577588
Institutional Source Beutler Lab
Gene Symbol Rhobtb3
Ensembl Gene ENSMUSG00000021589
Gene NameRho-related BTB domain containing 3
Synonyms2610033K01Rik, 4930503C18Rik, 1700040C17Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028493.2; MGI:1920546

Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75869537-75943925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75910741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 313 (V313M)
Ref Sequence ENSEMBL: ENSMUSP00000022078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022078] [ENSMUST00000109606]
Predicted Effect probably benign
Transcript: ENSMUST00000022078
AA Change: V313M

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022078
Gene: ENSMUSG00000021589
AA Change: V313M

DomainStartEndE-ValueType
Pfam:Ras 47 195 9e-7 PFAM
Blast:BTB 254 406 2e-95 BLAST
BTB 420 518 3.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109606
SMART Domains Protein: ENSMUSP00000105235
Gene: ENSMUSG00000021589

DomainStartEndE-ValueType
Pfam:Ras 45 195 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220939
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RHOBTB3 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (MIM 607351).[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality, reduced body weight and slightly reduced organ weights that varies by sex. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Rhobtb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rhobtb3 APN 13 75877428 missense probably damaging 1.00
IGL02142:Rhobtb3 APN 13 75877495 missense probably damaging 1.00
IGL02708:Rhobtb3 APN 13 75917724 missense probably damaging 0.99
IGL02732:Rhobtb3 APN 13 75910937 missense probably damaging 1.00
IGL02969:Rhobtb3 APN 13 75943431 missense probably damaging 1.00
R0048:Rhobtb3 UTSW 13 75902245 makesense probably null
R0285:Rhobtb3 UTSW 13 75877509 missense possibly damaging 0.86
R2233:Rhobtb3 UTSW 13 75872365 missense possibly damaging 0.76
R2289:Rhobtb3 UTSW 13 75910927 missense probably damaging 0.97
R2332:Rhobtb3 UTSW 13 75910852 missense probably benign 0.44
R3684:Rhobtb3 UTSW 13 75939481 missense probably damaging 1.00
R4685:Rhobtb3 UTSW 13 75878932 nonsense probably null
R5060:Rhobtb3 UTSW 13 75913270 missense probably benign
R5374:Rhobtb3 UTSW 13 75878895 missense probably damaging 0.98
R5688:Rhobtb3 UTSW 13 75872418 missense probably benign 0.01
R6181:Rhobtb3 UTSW 13 75910689 missense probably benign 0.05
R6235:Rhobtb3 UTSW 13 75892910 missense probably damaging 0.99
R6947:Rhobtb3 UTSW 13 75910666 missense probably benign 0.14
R7032:Rhobtb3 UTSW 13 75872394 missense probably benign 0.01
R7039:Rhobtb3 UTSW 13 75872453 nonsense probably null
R7148:Rhobtb3 UTSW 13 75910887 missense probably benign
R7508:Rhobtb3 UTSW 13 75878857 missense probably benign 0.00
R7598:Rhobtb3 UTSW 13 75910902 missense probably benign 0.00
R7691:Rhobtb3 UTSW 13 75878937 missense probably damaging 0.99
R7770:Rhobtb3 UTSW 13 75917815 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATAGACCATGAGCATCCTTCAC -3'
(R):5'- GGCATCACACTATCACTCCG -3'

Sequencing Primer
(F):5'- TGAGCATCCTTCACCTAGGCAG -3'
(R):5'- GACTTGAATAACTTGCTGCTCTG -3'
Posted On2019-10-07