Incidental Mutation 'R7449:Ghitm'
ID 577592
Institutional Source Beutler Lab
Gene Symbol Ghitm
Ensembl Gene ENSMUSG00000041028
Gene Name growth hormone inducible transmembrane protein
Synonyms PTD010, Tmbim5, C77840, 1010001P14Rik
MMRRC Submission 045524-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R7449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 36842401-36857279 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36853538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 101 (G101C)
Ref Sequence ENSEMBL: ENSMUSP00000046212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042564] [ENSMUST00000165649] [ENSMUST00000224769]
AlphaFold Q91VC9
Predicted Effect probably damaging
Transcript: ENSMUST00000042564
AA Change: G101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046212
Gene: ENSMUSG00000041028
AA Change: G101C

DomainStartEndE-ValueType
Pfam:BaxI_1 1 94 7.1e-16 PFAM
Pfam:BaxI_1 90 187 1.8e-17 PFAM
Pfam:Bax1-I 122 338 3.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165649
AA Change: G101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129712
Gene: ENSMUSG00000041028
AA Change: G101C

DomainStartEndE-ValueType
Pfam:BaxI_1 1 94 7.1e-16 PFAM
Pfam:BaxI_1 90 187 1.8e-17 PFAM
Pfam:Bax1-I 122 338 6.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224769
AA Change: G101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,035,131 (GRCm39) Y306N possibly damaging Het
Adgrv1 A T 13: 81,647,192 (GRCm39) V3116D probably damaging Het
Adss1 A T 12: 112,600,585 (GRCm39) T185S probably damaging Het
Ago2 G A 15: 73,018,348 (GRCm39) P30L probably damaging Het
Arb2a A G 13: 77,907,561 (GRCm39) I41V probably damaging Het
Atp5pf C T 16: 84,628,251 (GRCm39) V44M probably benign Het
Atp7b T A 8: 22,501,865 (GRCm39) I833F probably damaging Het
Birc6 T A 17: 75,009,336 (GRCm39) N4869K probably benign Het
Cacna1c C T 6: 118,579,310 (GRCm39) D1796N Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cnga1 A G 5: 72,762,647 (GRCm39) I289T probably benign Het
Crybg1 C A 10: 43,880,515 (GRCm39) E224D probably benign Het
Dysf T C 6: 84,114,362 (GRCm39) L1217P possibly damaging Het
Ebf2 T A 14: 67,647,469 (GRCm39) N339K probably damaging Het
Eva1c T C 16: 90,673,081 (GRCm39) probably null Het
Fam184a T C 10: 53,574,730 (GRCm39) E293G probably damaging Het
Folh1 G A 7: 86,380,956 (GRCm39) P506S probably benign Het
Ftcd A T 10: 76,415,997 (GRCm39) K210N probably benign Het
Gdf6 T A 4: 9,844,494 (GRCm39) V6D possibly damaging Het
Gimap5 T A 6: 48,729,838 (GRCm39) V136D probably damaging Het
Grm4 C T 17: 27,654,345 (GRCm39) G535D probably damaging Het
Gse1 T C 8: 120,956,450 (GRCm39) S314P unknown Het
Hnrnpdl A G 5: 100,185,014 (GRCm39) I279T probably damaging Het
Idi2l T A 13: 8,993,340 (GRCm39) H51L probably damaging Het
Itpr1 T C 6: 108,366,345 (GRCm39) S923P probably damaging Het
Krt39 C A 11: 99,408,887 (GRCm39) C303F probably benign Het
Lrrn1 T C 6: 107,545,482 (GRCm39) S427P possibly damaging Het
Lrrn3 T A 12: 41,503,487 (GRCm39) R277W probably damaging Het
Ltb4r1 T C 14: 56,005,375 (GRCm39) L226P probably damaging Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Mcoln1 T C 8: 3,557,285 (GRCm39) L125P probably damaging Het
Nid1 T G 13: 13,656,636 (GRCm39) V589G probably damaging Het
Nlrp5 T G 7: 23,116,951 (GRCm39) F225C probably benign Het
Notch3 C T 17: 32,376,940 (GRCm39) A322T probably damaging Het
Or14c43 A G 7: 86,115,063 (GRCm39) H148R probably benign Het
Or52a5b G T 7: 103,417,026 (GRCm39) Q193K probably benign Het
Or7g34 T A 9: 19,478,162 (GRCm39) T173S probably benign Het
Otogl A G 10: 107,639,524 (GRCm39) C1363R probably damaging Het
Ovol1 T A 19: 5,603,625 (GRCm39) D92V probably benign Het
Pigt T C 2: 164,344,419 (GRCm39) L356P probably damaging Het
Plekhg3 A G 12: 76,612,996 (GRCm39) Q434R probably damaging Het
Plekhh1 T C 12: 79,126,326 (GRCm39) F1344L probably benign Het
Polr1has A G 17: 37,275,275 (GRCm39) D16G probably damaging Het
Psmd3 T A 11: 98,586,377 (GRCm39) L515Q probably damaging Het
Pus1 A G 5: 110,922,452 (GRCm39) L405P probably damaging Het
Qtrt2 T A 16: 43,701,395 (GRCm39) H55L probably benign Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Raver2 T A 4: 100,959,860 (GRCm39) H113Q probably damaging Het
Recql4 T C 15: 76,589,765 (GRCm39) D760G unknown Het
Rhobtb3 C T 13: 76,058,860 (GRCm39) V313M probably benign Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rnf185 T C 11: 3,376,578 (GRCm39) Q135R probably benign Het
Sema3f T C 9: 107,561,235 (GRCm39) S584G probably damaging Het
Sh3pxd2a T A 19: 47,256,091 (GRCm39) T904S probably benign Het
Slc4a10 T C 2: 62,134,290 (GRCm39) V1002A probably benign Het
Taf1b T C 12: 24,554,992 (GRCm39) I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Tenm4 A T 7: 96,523,420 (GRCm39) D1654V possibly damaging Het
Tgfb1 G A 7: 25,404,263 (GRCm39) V357M probably damaging Het
Tnxb C T 17: 34,922,335 (GRCm39) P2383S possibly damaging Het
Trpm1 A T 7: 63,858,723 (GRCm39) M382L probably benign Het
Trrap A G 5: 144,788,019 (GRCm39) Y3516C probably damaging Het
Txnrd1 T A 10: 82,721,067 (GRCm39) Y494* probably null Het
Ubr2 C T 17: 47,275,714 (GRCm39) E811K probably damaging Het
Ubxn4 T A 1: 128,172,280 (GRCm39) F25I possibly damaging Het
Vmn2r117 A G 17: 23,678,869 (GRCm39) M785T probably damaging Het
Vmn2r99 G A 17: 19,599,407 (GRCm39) D364N probably benign Het
Vps45 C A 3: 95,954,448 (GRCm39) probably null Het
Wdr25 A C 12: 108,992,367 (GRCm39) H426P probably damaging Het
Wdr83 A T 8: 85,806,310 (GRCm39) W136R probably damaging Het
Xylt1 A C 7: 117,191,232 (GRCm39) I343L possibly damaging Het
Zscan4b T C 7: 10,637,985 (GRCm39) Q53R possibly damaging Het
Other mutations in Ghitm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ghitm APN 14 36,847,203 (GRCm39) missense probably benign 0.00
IGL02315:Ghitm APN 14 36,853,521 (GRCm39) missense probably benign 0.04
R0058:Ghitm UTSW 14 36,853,549 (GRCm39) missense probably damaging 1.00
R0058:Ghitm UTSW 14 36,853,549 (GRCm39) missense probably damaging 1.00
R0090:Ghitm UTSW 14 36,844,176 (GRCm39) missense probably benign
R0386:Ghitm UTSW 14 36,847,868 (GRCm39) missense possibly damaging 0.95
R1969:Ghitm UTSW 14 36,853,586 (GRCm39) missense probably benign 0.00
R4019:Ghitm UTSW 14 36,852,651 (GRCm39) missense probably damaging 0.99
R4727:Ghitm UTSW 14 36,855,700 (GRCm39) missense probably damaging 0.99
R5364:Ghitm UTSW 14 36,847,174 (GRCm39) missense probably damaging 0.99
R5364:Ghitm UTSW 14 36,847,156 (GRCm39) missense probably benign 0.00
R6107:Ghitm UTSW 14 36,847,166 (GRCm39) missense probably damaging 1.00
R6519:Ghitm UTSW 14 36,847,204 (GRCm39) missense probably damaging 0.98
R6587:Ghitm UTSW 14 36,847,146 (GRCm39) nonsense probably null
R6855:Ghitm UTSW 14 36,847,859 (GRCm39) missense probably null 1.00
R9429:Ghitm UTSW 14 36,852,655 (GRCm39) missense probably damaging 1.00
R9446:Ghitm UTSW 14 36,853,606 (GRCm39) missense possibly damaging 0.80
R9789:Ghitm UTSW 14 36,852,719 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGACTTCTTAGAGCTGTTGAAG -3'
(R):5'- TCTGTATCCCCAAGGTGACTAC -3'

Sequencing Primer
(F):5'- TGGCGGCTAATAACCATCTG -3'
(R):5'- GCTGATTCTAGCCTGTGT -3'
Posted On 2019-10-07