Incidental Mutation 'R7449:Ltb4r1'
ID577593
Institutional Source Beutler Lab
Gene Symbol Ltb4r1
Ensembl Gene ENSMUSG00000046908
Gene Nameleukotriene B4 receptor 1
SynonymsmBLTR, BLTR, BLT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55765962-55768494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55767918 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Ref Sequence ENSEMBL: ENSMUSP00000051368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000044554] [ENSMUST00000057569] [ENSMUST00000170223]
Predicted Effect probably benign
Transcript: ENSMUST00000002398
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044554
SMART Domains Protein: ENSMUSP00000048358
Gene: ENSMUSG00000040432

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:7tm_1 37 288 5.7e-31 PFAM
low complexity region 309 323 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057569
AA Change: L226P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051368
Gene: ENSMUSG00000046908
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 28 196 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 31 249 2e-8 PFAM
Pfam:7tm_1 37 285 1.3e-42 PFAM
Pfam:Serpentine_r_xa 54 201 2.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170223
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mutations cause impaired Ltb4-driven chemotaxis and adhesion. Homozygous null phenotypes include attenuated autoAb-driven arthritis, adoptive transfer-induced uveitis, airway hyperresponsiveness and Th2-type immune responses, and reduced eosinophil recruitment in induced peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Ltb4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1104:Ltb4r1 UTSW 14 55767375 missense probably damaging 1.00
R1626:Ltb4r1 UTSW 14 55767242 start codon destroyed probably null
R4066:Ltb4r1 UTSW 14 55767495 missense probably damaging 1.00
R4680:Ltb4r1 UTSW 14 55767468 missense probably damaging 1.00
R5501:Ltb4r1 UTSW 14 55768082 missense probably damaging 1.00
R5584:Ltb4r1 UTSW 14 55767387 missense possibly damaging 0.81
R6368:Ltb4r1 UTSW 14 55767743 missense probably benign 0.00
R8121:Ltb4r1 UTSW 14 55768122 missense probably damaging 1.00
RF007:Ltb4r1 UTSW 14 55767969 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGATCTGCGCTCCGAACTATC -3'
(R):5'- AGTAGCTTGACCACGAAGC -3'

Sequencing Primer
(F):5'- TGCGCTCCGAACTATCCCAAC -3'
(R):5'- TTGACCACGAAGCCCACG -3'
Posted On2019-10-07