Incidental Mutation 'R7449:Recql4'
ID577597
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76705565 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 760 (D760G)
Ref Sequence ENSEMBL: ENSMUSP00000155694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036852] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000230544
AA Change: D760G
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 splice site probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
R8314:Recql4 UTSW 15 76710180 missense probably damaging 1.00
R8480:Recql4 UTSW 15 76704505 missense probably benign 0.03
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGAAGTCAGTGCTGTCAGC -3'
(R):5'- GTACAACAGGCCTTCATGCG -3'

Sequencing Primer
(F):5'- CTGTCAGCGTGGGCATGTC -3'
(R):5'- AGTGGCCACGGTAGCATTTG -3'
Posted On2019-10-07