Mutagenetix > Incidental Mutations

Incidental Mutation 'R7449:Recql4'

577597

Institutional Source

Beutler Lab

Gene Symbol

Recql4

Ensembl Gene

ENSMUSG00000033762

Gene Name

RecQ protein-like 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76703553-76710548 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76705565 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 760 (D760G)

Ref Sequence

ENSEMBL: ENSMUSP00000155694 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036852] [ENSMUST00000230544] [ENSMUST00000230724]

Predicted Effect

probably benign
Transcript: ENSMUST00000019224

SMART Domains

Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

Domain	Start	End	E-Value	Type
Pfam:MFS_1	8	373	3e-16	PFAM
transmembrane domain	388	407	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036852

SMART Domains

Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

Domain	Start	End	E-Value	Type
Pfam:Drc1-Sld2	4	132	2.8e-14	PFAM
low complexity region	169	187	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
ZnF_C2HC	394	410	5.67e-5	SMART
DEXDc	494	701	5.86e-28	SMART
HELICc	736	831	1.48e-24	SMART
Blast:DEXDc	902	1117	3e-46	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000230544
AA Change: D760G

Predicted Effect

probably benign
Transcript: ENSMUST00000230724

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Recql4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Recql4	APN	15	76707336	missense	possibly damaging	0.52
IGL01287:Recql4	APN	15	76709912	splice site	probably benign
IGL01470:Recql4	APN	15	76708944	missense	probably benign	0.40
IGL01809:Recql4	APN	15	76708870	nonsense	probably null
IGL02094:Recql4	APN	15	76709517	missense	probably benign	0.01
IGL02303:Recql4	APN	15	76708571	missense	possibly damaging	0.64
IGL02702:Recql4	APN	15	76707285	missense	probably damaging	1.00
IGL03086:Recql4	APN	15	76706268	missense	probably benign	0.30
IGL03162:Recql4	APN	15	76706096	splice site	probably null
ANU74:Recql4	UTSW	15	76705757	missense	possibly damaging	0.47
F5770:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
R0688:Recql4	UTSW	15	76709809	splice site	probably null
R1171:Recql4	UTSW	15	76704039	missense	possibly damaging	0.94
R1348:Recql4	UTSW	15	76709211	missense	probably benign	0.01
R1487:Recql4	UTSW	15	76708983	missense	probably benign	0.11
R1547:Recql4	UTSW	15	76706311	missense	probably damaging	0.99
R1917:Recql4	UTSW	15	76703837	nonsense	probably null
R3813:Recql4	UTSW	15	76704494	missense	possibly damaging	0.67
R4066:Recql4	UTSW	15	76705827	missense	probably damaging	1.00
R4363:Recql4	UTSW	15	76706044	missense	probably benign	0.07
R4387:Recql4	UTSW	15	76705958	missense	probably benign	0.00
R4388:Recql4	UTSW	15	76705958	missense	probably benign	0.00
R4700:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R4701:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R4923:Recql4	UTSW	15	76710181	missense	probably damaging	1.00
R5075:Recql4	UTSW	15	76709544	missense	probably damaging	1.00
R5103:Recql4	UTSW	15	76706756	missense	probably damaging	1.00
R5226:Recql4	UTSW	15	76710129	missense	probably benign
R5500:Recql4	UTSW	15	76705578	intron	probably benign
R5547:Recql4	UTSW	15	76705794	nonsense	probably null
R5824:Recql4	UTSW	15	76708585	missense	probably damaging	1.00
R5976:Recql4	UTSW	15	76709424	missense	probably benign	0.01
R6086:Recql4	UTSW	15	76704587	missense	probably damaging	0.96
R6756:Recql4	UTSW	15	76704859	missense	probably benign	0.00
R7075:Recql4	UTSW	15	76706424	missense	possibly damaging	0.95
R7086:Recql4	UTSW	15	76705553	missense	unknown
R7653:Recql4	UTSW	15	76703782	missense	probably benign	0.01
R8314:Recql4	UTSW	15	76710180	missense	probably damaging	1.00
R8480:Recql4	UTSW	15	76704505	missense	probably benign	0.03
V7580:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
V7581:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79
V7583:Recql4	UTSW	15	76706169	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AGGAAGTCAGTGCTGTCAGC -3'
(R):5'- GTACAACAGGCCTTCATGCG -3'

Sequencing Primer
(F):5'- CTGTCAGCGTGGGCATGTC -3'
(R):5'- AGTGGCCACGGTAGCATTTG -3'

Posted On

2019-10-07