Incidental Mutation 'R7449:Grm4'
ID577603
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Nameglutamate receptor, metabotropic 4
SynonymsmGluR4, Gprc1d
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location27422387-27521403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27435371 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 535 (G535D)
Ref Sequence ENSEMBL: ENSMUSP00000112578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
Predicted Effect probably damaging
Transcript: ENSMUST00000118161
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: G535D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118489
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239
AA Change: G535D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231290
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231416
AA Change: G280D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231809
AA Change: G488D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27434737 nonsense probably null
IGL02380:Grm4 APN 17 27434661 missense probably damaging 1.00
IGL03244:Grm4 APN 17 27434823 missense probably damaging 0.99
R0013:Grm4 UTSW 17 27431575 missense probably benign 0.01
R0352:Grm4 UTSW 17 27451891 splice site probably benign
R0599:Grm4 UTSW 17 27431490 missense probably benign 0.39
R0616:Grm4 UTSW 17 27434564 missense probably damaging 1.00
R0645:Grm4 UTSW 17 27435209 missense probably damaging 1.00
R0726:Grm4 UTSW 17 27438438 splice site probably benign
R1085:Grm4 UTSW 17 27473033 missense probably damaging 1.00
R1486:Grm4 UTSW 17 27434717 missense probably damaging 1.00
R1535:Grm4 UTSW 17 27434801 missense probably benign 0.01
R1799:Grm4 UTSW 17 27472940 missense probably damaging 0.99
R1914:Grm4 UTSW 17 27434712 missense probably damaging 0.99
R2472:Grm4 UTSW 17 27434675 missense probably damaging 1.00
R3759:Grm4 UTSW 17 27435299 missense probably benign 0.00
R4244:Grm4 UTSW 17 27502735 missense probably damaging 1.00
R5390:Grm4 UTSW 17 27434738 missense probably damaging 1.00
R5476:Grm4 UTSW 17 27434798 missense probably benign 0.04
R5516:Grm4 UTSW 17 27438411 missense probably benign 0.06
R5897:Grm4 UTSW 17 27435163 missense probably benign 0.02
R5956:Grm4 UTSW 17 27435155 missense probably benign 0.01
R6391:Grm4 UTSW 17 27435320 missense probably benign 0.00
R7330:Grm4 UTSW 17 27434824 nonsense probably null
R8338:Grm4 UTSW 17 27435003 missense probably damaging 1.00
Z1177:Grm4 UTSW 17 27450194 nonsense probably null
Z1177:Grm4 UTSW 17 27450221 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTAGCGCACAAAAGTGACC -3'
(R):5'- GCCTATTCAGGTGTGGAGATAG -3'

Sequencing Primer
(F):5'- ACAGCGTGGCAGCAATGC -3'
(R):5'- TAGAGAGAAGGTCTGGGCGC -3'
Posted On2019-10-07