Mutagenetix > Incidental Mutations

Incidental Mutation 'R7449:Grm4'

577603

Institutional Source

Beutler Lab

Gene Symbol

Grm4

Ensembl Gene

ENSMUSG00000063239

Gene Name

glutamate receptor, metabotropic 4

Synonyms

mGluR4, Gprc1d

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27422387-27521403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27435371 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 535 (G535D)

Ref Sequence

ENSEMBL: ENSMUSP00000112578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]

Predicted Effect

probably damaging
Transcript: ENSMUST00000118161
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: G535D

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	482	1.4e-110	PFAM
Pfam:Peripla_BP_6	144	486	9e-13	PFAM
Pfam:NCD3G	516	566	2.4e-14	PFAM
Pfam:7tm_3	599	844	7.6e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118489
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239
AA Change: G535D

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	482	6.2e-104	PFAM
Pfam:Peripla_BP_6	144	486	8.3e-12	PFAM
Pfam:NCD3G	516	566	5.4e-15	PFAM
Pfam:7tm_3	597	817	1.9e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000231290
AA Change: G535D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231416
AA Change: G280D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231809
AA Change: G488D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000232243

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Grm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Grm4	APN	17	27434737	nonsense	probably null
IGL02380:Grm4	APN	17	27434661	missense	probably damaging	1.00
IGL03244:Grm4	APN	17	27434823	missense	probably damaging	0.99
R0013:Grm4	UTSW	17	27431575	missense	probably benign	0.01
R0352:Grm4	UTSW	17	27451891	splice site	probably benign
R0599:Grm4	UTSW	17	27431490	missense	probably benign	0.39
R0616:Grm4	UTSW	17	27434564	missense	probably damaging	1.00
R0645:Grm4	UTSW	17	27435209	missense	probably damaging	1.00
R0726:Grm4	UTSW	17	27438438	splice site	probably benign
R1085:Grm4	UTSW	17	27473033	missense	probably damaging	1.00
R1486:Grm4	UTSW	17	27434717	missense	probably damaging	1.00
R1535:Grm4	UTSW	17	27434801	missense	probably benign	0.01
R1799:Grm4	UTSW	17	27472940	missense	probably damaging	0.99
R1914:Grm4	UTSW	17	27434712	missense	probably damaging	0.99
R2472:Grm4	UTSW	17	27434675	missense	probably damaging	1.00
R3759:Grm4	UTSW	17	27435299	missense	probably benign	0.00
R4244:Grm4	UTSW	17	27502735	missense	probably damaging	1.00
R5390:Grm4	UTSW	17	27434738	missense	probably damaging	1.00
R5476:Grm4	UTSW	17	27434798	missense	probably benign	0.04
R5516:Grm4	UTSW	17	27438411	missense	probably benign	0.06
R5897:Grm4	UTSW	17	27435163	missense	probably benign	0.02
R5956:Grm4	UTSW	17	27435155	missense	probably benign	0.01
R6391:Grm4	UTSW	17	27435320	missense	probably benign	0.00
R7330:Grm4	UTSW	17	27434824	nonsense	probably null
R8338:Grm4	UTSW	17	27435003	missense	probably damaging	1.00
Z1177:Grm4	UTSW	17	27450194	nonsense	probably null
Z1177:Grm4	UTSW	17	27450221	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TGTAGCGCACAAAAGTGACC -3'
(R):5'- GCCTATTCAGGTGTGGAGATAG -3'

Sequencing Primer
(F):5'- ACAGCGTGGCAGCAATGC -3'
(R):5'- TAGAGAGAAGGTCTGGGCGC -3'

Posted On

2019-10-07