Incidental Mutation 'R7449:Notch3'
ID577604
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32157966 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 322 (A322T)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: A322T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: A322T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 splice site probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
R8458:Notch3 UTSW 17 32156050 missense probably damaging 1.00
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTTCCAAACCCAGGGTC -3'
(R):5'- CGGGCAACTTAGACTAGCAC -3'

Sequencing Primer
(F):5'- CTAAGGATTAAACTCAGAGCCTGTGC -3'
(R):5'- GGGCAACTTAGACTAGCACATCTTTG -3'
Posted On2019-10-07