Incidental Mutation 'R7449:Tnxb'
ID577605
Institutional Source Beutler Lab
Gene Symbol Tnxb
Ensembl Gene ENSMUSG00000033327
Gene Nametenascin XB
SynonymsTnx, TN-MHC
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34670535-34719815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34703361 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2383 (P2383S)
Ref Sequence ENSEMBL: ENSMUSP00000084661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087399] [ENSMUST00000168533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087399
AA Change: P2383S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084661
Gene: ENSMUSG00000033327
AA Change: P2383S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 1047 1126 3.97e-5 SMART
FN3 1142 1223 3.62e-8 SMART
low complexity region 1230 1241 N/A INTRINSIC
FN3 1242 1320 2.31e-6 SMART
FN3 1351 1431 8.77e-7 SMART
FN3 1460 1539 3.01e-5 SMART
FN3 1556 1636 2.76e-4 SMART
FN3 1657 1736 5.78e-7 SMART
FN3 1752 1832 4.7e-7 SMART
FN3 1851 1929 1.95e-4 SMART
FN3 1955 2034 4.56e-5 SMART
FN3 2066 2145 2.23e-8 SMART
FN3 2164 2244 7.75e-8 SMART
FN3 2279 2358 8.5e-5 SMART
FN3 2387 2467 2.94e-8 SMART
FN3 2501 2580 1.7e-4 SMART
low complexity region 2588 2598 N/A INTRINSIC
FN3 2607 2687 6.75e-8 SMART
FN3 2716 2795 7.4e-5 SMART
FN3 2822 2902 1.35e-7 SMART
FN3 2931 3010 5.61e-5 SMART
FN3 3026 3106 6.01e-5 SMART
FN3 3120 3199 6.45e-5 SMART
FN3 3214 3293 9.54e-8 SMART
FN3 3316 3396 2.81e-5 SMART
FN3 3416 3502 1.98e-5 SMART
FN3 3518 3596 5.65e-10 SMART
FN3 3607 3682 7.63e-7 SMART
FN3 3695 3770 6.54e-6 SMART
FBG 3787 3997 8.88e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168533
SMART Domains Protein: ENSMUSP00000127487
Gene: ENSMUSG00000033327

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
EGF 173 201 1.59e1 SMART
EGF 204 232 7.41e0 SMART
EGF 235 263 2.64e1 SMART
EGF 266 294 2.64e1 SMART
EGF 297 325 9.13e0 SMART
EGF 328 356 2.07e1 SMART
EGF_like 359 387 3.16e1 SMART
EGF_like 390 418 4.64e1 SMART
EGF_like 421 449 3.29e1 SMART
EGF_like 452 480 7.09e1 SMART
EGF 483 511 1.15e1 SMART
EGF 514 542 1.91e1 SMART
EGF_like 545 573 4.11e1 SMART
EGF 576 604 7.95e0 SMART
EGF 607 635 1.23e1 SMART
EGF_like 638 666 4.93e1 SMART
EGF_like 674 702 5.24e1 SMART
EGF 705 733 2.29e1 SMART
FN3 736 816 4.12e-3 SMART
FN3 827 904 1.21e-9 SMART
FN3 924 1003 3.97e-5 SMART
FN3 1019 1100 3.62e-8 SMART
low complexity region 1107 1118 N/A INTRINSIC
FN3 1119 1197 2.31e-6 SMART
FN3 1228 1308 8.77e-7 SMART
FN3 1337 1416 3.01e-5 SMART
FN3 1433 1513 2.76e-4 SMART
FN3 1534 1613 5.78e-7 SMART
FN3 1629 1709 4.7e-7 SMART
FN3 1728 1806 1.95e-4 SMART
FN3 1832 1911 4.56e-5 SMART
FN3 1943 2022 2.23e-8 SMART
FN3 2051 2130 5.61e-5 SMART
FN3 2146 2226 6.01e-5 SMART
FN3 2240 2319 6.45e-5 SMART
FN3 2334 2413 9.54e-8 SMART
FN3 2436 2516 2.81e-5 SMART
FN3 2536 2622 1.98e-5 SMART
FN3 2638 2716 5.65e-10 SMART
FN3 2727 2802 7.63e-7 SMART
FN3 2815 2890 6.54e-6 SMART
FBG 2907 3117 8.88e-125 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have stretchy skin, similar to patients with human Ehlers-Danlos syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Tnxb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnxb APN 17 34685629 missense probably damaging 1.00
IGL00424:Tnxb APN 17 34714692 missense probably damaging 1.00
IGL00486:Tnxb APN 17 34692382 missense probably damaging 1.00
IGL00952:Tnxb APN 17 34713128 missense probably damaging 1.00
IGL00974:Tnxb APN 17 34718733 critical splice donor site probably null
IGL01017:Tnxb APN 17 34693808 missense probably damaging 0.98
IGL01082:Tnxb APN 17 34714610 missense probably damaging 0.97
IGL01397:Tnxb APN 17 34714673 missense probably damaging 0.99
IGL01473:Tnxb APN 17 34685701 missense probably damaging 0.99
IGL01642:Tnxb APN 17 34718514 missense probably damaging 1.00
IGL01774:Tnxb APN 17 34688839 missense probably damaging 1.00
IGL01971:Tnxb APN 17 34672297 missense probably damaging 1.00
IGL02016:Tnxb APN 17 34672275 missense probably damaging 0.98
IGL02160:Tnxb APN 17 34714745 missense probably benign 0.01
IGL02473:Tnxb APN 17 34717762 missense probably damaging 1.00
IGL02666:Tnxb APN 17 34684939 missense probably benign 0.20
IGL02831:Tnxb APN 17 34703571 missense possibly damaging 0.93
IGL02838:Tnxb APN 17 34689632 missense possibly damaging 0.74
IGL02965:Tnxb APN 17 34709654 missense possibly damaging 0.93
IGL03155:Tnxb APN 17 34713595 missense probably damaging 1.00
IGL03194:Tnxb APN 17 34695947 nonsense probably null
IGL03215:Tnxb APN 17 34692525 missense possibly damaging 0.66
IGL03256:Tnxb APN 17 34688720 missense probably damaging 1.00
E0370:Tnxb UTSW 17 34678943 missense probably damaging 1.00
R0006:Tnxb UTSW 17 34682292 missense probably benign 0.07
R0049:Tnxb UTSW 17 34709568 missense possibly damaging 0.93
R0050:Tnxb UTSW 17 34673325 missense probably damaging 1.00
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0233:Tnxb UTSW 17 34699033 missense probably benign 0.32
R0311:Tnxb UTSW 17 34716984 missense probably damaging 0.97
R0326:Tnxb UTSW 17 34698179 missense probably benign 0.32
R0387:Tnxb UTSW 17 34683574 missense probably benign 0.30
R0396:Tnxb UTSW 17 34671733 missense probably damaging 1.00
R0511:Tnxb UTSW 17 34718245 missense probably damaging 0.96
R0540:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0563:Tnxb UTSW 17 34716947 missense probably benign 0.05
R0575:Tnxb UTSW 17 34717206 missense possibly damaging 0.91
R0586:Tnxb UTSW 17 34672144 missense probably damaging 1.00
R0607:Tnxb UTSW 17 34671918 missense probably damaging 1.00
R0622:Tnxb UTSW 17 34718729 missense probably damaging 1.00
R0624:Tnxb UTSW 17 34683548 missense probably damaging 1.00
R0709:Tnxb UTSW 17 34689354 missense probably damaging 1.00
R0898:Tnxb UTSW 17 34670745 missense probably damaging 1.00
R0970:Tnxb UTSW 17 34698943 missense possibly damaging 0.85
R0972:Tnxb UTSW 17 34685143 missense probably damaging 1.00
R1118:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1119:Tnxb UTSW 17 34685043 missense probably damaging 1.00
R1226:Tnxb UTSW 17 34688929 missense probably damaging 1.00
R1296:Tnxb UTSW 17 34671577 missense probably damaging 1.00
R1297:Tnxb UTSW 17 34710166 missense probably damaging 0.96
R1349:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1356:Tnxb UTSW 17 34695472 missense possibly damaging 0.53
R1372:Tnxb UTSW 17 34710293 missense possibly damaging 0.67
R1521:Tnxb UTSW 17 34711503 missense probably damaging 1.00
R1522:Tnxb UTSW 17 34718638 missense probably damaging 1.00
R1532:Tnxb UTSW 17 34710830 missense probably damaging 1.00
R1735:Tnxb UTSW 17 34717970 missense probably damaging 1.00
R1778:Tnxb UTSW 17 34683574 missense probably benign 0.30
R1802:Tnxb UTSW 17 34703889 missense probably damaging 0.98
R1824:Tnxb UTSW 17 34692333 nonsense probably null
R1838:Tnxb UTSW 17 34678910 missense probably damaging 0.96
R1863:Tnxb UTSW 17 34670874 missense probably damaging 1.00
R1865:Tnxb UTSW 17 34703457 nonsense probably null
R1867:Tnxb UTSW 17 34671847 missense probably damaging 1.00
R1883:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1884:Tnxb UTSW 17 34689565 missense probably benign 0.01
R1889:Tnxb UTSW 17 34695825 missense probably damaging 0.97
R1969:Tnxb UTSW 17 34679081 missense probably benign 0.20
R1989:Tnxb UTSW 17 34683377 missense probably benign 0.08
R1989:Tnxb UTSW 17 34693885 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R1991:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R1992:Tnxb UTSW 17 34671904 missense probably damaging 1.00
R2001:Tnxb UTSW 17 34692579 missense possibly damaging 0.82
R2018:Tnxb UTSW 17 34671750 missense probably benign 0.04
R2030:Tnxb UTSW 17 34718469 missense probably damaging 1.00
R2037:Tnxb UTSW 17 34699205 missense probably damaging 1.00
R2103:Tnxb UTSW 17 34682251 missense probably damaging 1.00
R2116:Tnxb UTSW 17 34672227 missense probably damaging 1.00
R2206:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2207:Tnxb UTSW 17 34709417 missense possibly damaging 0.86
R2215:Tnxb UTSW 17 34704140 missense possibly damaging 0.93
R2413:Tnxb UTSW 17 34718278 missense probably damaging 0.99
R2680:Tnxb UTSW 17 34703620 missense possibly damaging 0.51
R2910:Tnxb UTSW 17 34672450 missense probably damaging 1.00
R2984:Tnxb UTSW 17 34678662 nonsense probably null
R3120:Tnxb UTSW 17 34692355 missense possibly damaging 0.86
R3429:Tnxb UTSW 17 34672631 nonsense probably null
R3429:Tnxb UTSW 17 34703587 missense probably damaging 0.98
R3552:Tnxb UTSW 17 34718721 missense probably damaging 1.00
R3698:Tnxb UTSW 17 34690433 critical splice donor site probably null
R3720:Tnxb UTSW 17 34712964 missense possibly damaging 0.95
R3841:Tnxb UTSW 17 34698923 missense possibly damaging 0.72
R3848:Tnxb UTSW 17 34690395 missense possibly damaging 0.82
R3886:Tnxb UTSW 17 34718911 missense probably damaging 1.00
R4074:Tnxb UTSW 17 34671871 missense probably benign 0.22
R4159:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4160:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4161:Tnxb UTSW 17 34711517 missense probably damaging 0.99
R4181:Tnxb UTSW 17 34709454 missense possibly damaging 0.93
R4210:Tnxb UTSW 17 34710977 missense possibly damaging 0.84
R4275:Tnxb UTSW 17 34698231 missense probably damaging 0.98
R4329:Tnxb UTSW 17 34693864 missense probably damaging 1.00
R4394:Tnxb UTSW 17 34678662 nonsense probably null
R4395:Tnxb UTSW 17 34678662 nonsense probably null
R4397:Tnxb UTSW 17 34678662 nonsense probably null
R4540:Tnxb UTSW 17 34703335 missense possibly damaging 0.86
R4673:Tnxb UTSW 17 34672540 missense probably damaging 0.99
R4719:Tnxb UTSW 17 34689420 missense probably damaging 1.00
R4725:Tnxb UTSW 17 34699067 missense probably damaging 0.99
R4753:Tnxb UTSW 17 34695935 missense possibly damaging 0.71
R4777:Tnxb UTSW 17 34671943 missense probably damaging 1.00
R4837:Tnxb UTSW 17 34718007 missense probably damaging 0.98
R4898:Tnxb UTSW 17 34695592 missense possibly damaging 0.95
R4938:Tnxb UTSW 17 34713632 missense probably damaging 1.00
R5044:Tnxb UTSW 17 34717483 missense probably damaging 1.00
R5100:Tnxb UTSW 17 34710928 missense probably damaging 0.99
R5223:Tnxb UTSW 17 34704078 missense possibly damaging 0.51
R5269:Tnxb UTSW 17 34703608 missense possibly damaging 0.95
R5333:Tnxb UTSW 17 34690231 missense probably damaging 1.00
R5454:Tnxb UTSW 17 34709625 missense possibly damaging 0.71
R5470:Tnxb UTSW 17 34716973 missense probably null 1.00
R5475:Tnxb UTSW 17 34689593 missense probably damaging 1.00
R5574:Tnxb UTSW 17 34711024 missense probably benign
R5596:Tnxb UTSW 17 34688804 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690202 missense probably damaging 1.00
R5599:Tnxb UTSW 17 34690205 missense probably benign 0.22
R5615:Tnxb UTSW 17 34683418 missense probably damaging 1.00
R5620:Tnxb UTSW 17 34717530 nonsense probably null
R5625:Tnxb UTSW 17 34685211 missense probably benign 0.30
R5734:Tnxb UTSW 17 34698910 missense possibly damaging 0.53
R5896:Tnxb UTSW 17 34672152 missense probably damaging 1.00
R5961:Tnxb UTSW 17 34718635 missense probably damaging 1.00
R5974:Tnxb UTSW 17 34685707 missense probably damaging 1.00
R6091:Tnxb UTSW 17 34710364 missense probably damaging 0.98
R6134:Tnxb UTSW 17 34672012 missense probably damaging 0.96
R6325:Tnxb UTSW 17 34692424 missense probably damaging 1.00
R6358:Tnxb UTSW 17 34678994 missense probably damaging 0.98
R6362:Tnxb UTSW 17 34694388 missense probably damaging 1.00
R6432:Tnxb UTSW 17 34717917 missense probably damaging 1.00
R6461:Tnxb UTSW 17 34671898 missense probably damaging 1.00
R6467:Tnxb UTSW 17 34693924 missense probably damaging 1.00
R6476:Tnxb UTSW 17 34690192 missense probably damaging 0.98
R6477:Tnxb UTSW 17 34719539 missense probably damaging 1.00
R6631:Tnxb UTSW 17 34718248 missense probably damaging 1.00
R6774:Tnxb UTSW 17 34709632 nonsense probably null
R6787:Tnxb UTSW 17 34710736 missense probably benign 0.02
R6805:Tnxb UTSW 17 34698153 missense possibly damaging 0.93
R6860:Tnxb UTSW 17 34713157 missense probably damaging 0.99
R6883:Tnxb UTSW 17 34718519 missense probably damaging 1.00
R7049:Tnxb UTSW 17 34717268 critical splice donor site probably null
R7107:Tnxb UTSW 17 34671340 missense unknown
R7172:Tnxb UTSW 17 34696020 missense probably damaging 1.00
R7206:Tnxb UTSW 17 34704101 missense possibly damaging 0.71
R7219:Tnxb UTSW 17 34679065 missense probably benign 0.08
R7237:Tnxb UTSW 17 34682196 missense possibly damaging 0.82
R7257:Tnxb UTSW 17 34716501 missense probably benign 0.44
R7269:Tnxb UTSW 17 34695454 missense probably damaging 1.00
R7302:Tnxb UTSW 17 34678901 missense probably benign 0.41
R7372:Tnxb UTSW 17 34717254 missense possibly damaging 0.72
R7384:Tnxb UTSW 17 34718518 missense probably damaging 1.00
R7447:Tnxb UTSW 17 34718470 missense probably damaging 1.00
R7480:Tnxb UTSW 17 34715773 missense probably damaging 0.96
R7506:Tnxb UTSW 17 34715691 missense possibly damaging 0.89
R7586:Tnxb UTSW 17 34716408 missense probably damaging 0.98
R7688:Tnxb UTSW 17 34671906 missense probably benign 0.23
R7690:Tnxb UTSW 17 34689520 missense probably benign 0.03
R7690:Tnxb UTSW 17 34689527 missense probably damaging 1.00
R7732:Tnxb UTSW 17 34694280 missense probably damaging 1.00
R7735:Tnxb UTSW 17 34671424 missense unknown
R7760:Tnxb UTSW 17 34712937 missense probably damaging 0.96
X0004:Tnxb UTSW 17 34703415 missense possibly damaging 0.71
X0010:Tnxb UTSW 17 34671934 missense probably damaging 1.00
X0019:Tnxb UTSW 17 34694189 missense possibly damaging 0.51
X0063:Tnxb UTSW 17 34703508 missense probably damaging 0.98
X0064:Tnxb UTSW 17 34694032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTTTCAGAATGGGGAC -3'
(R):5'- ATGGTGACCTGGTCCTCATG -3'

Sequencing Primer
(F):5'- CAGATCAGGTTGGCTTTGAACTCAC -3'
(R):5'- TGGTCCTCATGCCCTGG -3'
Posted On2019-10-07