Mutagenetix > Incidental Mutation

Incidental Mutation 'R7449:Ubr2'

577607

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R7449 (G1)

Quality Score

189.009

Status

Not validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46964788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 811 (E811K)

Ref Sequence

ENSEMBL: ENSMUSP00000108961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]

AlphaFold

Q6WKZ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000113335
AA Change: E811K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: E811K

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113337
AA Change: E811K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: E811K

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225599

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
R9026:Ubr2	UTSW	17	46934115	missense	probably damaging	1.00
R9216:Ubr2	UTSW	17	46981359	missense	probably benign	0.36
R9339:Ubr2	UTSW	17	46973939	missense	probably benign	0.30
R9558:Ubr2	UTSW	17	46951917	missense	not run
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGCTCGCCCTTAGTTGTATC -3'
(R):5'- TTCAGCTAGCTGTGTAATCTCC -3'

Sequencing Primer
(F):5'- AAAGACACTTGCCGTCCAGTTTG -3'
(R):5'- CAGTCTTTAAGCACAGTGGC -3'

Posted On

2019-10-07