Incidental Mutation 'R7449:Ovol1'
ID577609
Institutional Source Beutler Lab
Gene Symbol Ovol1
Ensembl Gene ENSMUSG00000024922
Gene Nameovo like zinc finger 1
SynonymsOvo1, movo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5549137-5560575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5553597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 92 (D92V)
Ref Sequence ENSEMBL: ENSMUSP00000025861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025861]
Predicted Effect probably benign
Transcript: ENSMUST00000025861
AA Change: D92V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025861
Gene: ENSMUSG00000024922
AA Change: D92V

DomainStartEndE-ValueType
ZnF_C2H2 118 140 1.1e-2 SMART
ZnF_C2H2 146 168 1.82e-3 SMART
ZnF_C2H2 174 197 2.99e-4 SMART
ZnF_C2H2 213 236 8.09e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative zinc finger containing transcription factor that is highly similar to homologous protein in Drosophila and mouse. Based on known functions in these species, this protein is likely involved in hair formation and spermatogenesis in human as well. [provided by RefSeq, Aug 2011]
PHENOTYPE: Null mutant homozygotes show reduced growth, abnormal hair, and cystic kidneys. Females are subfertile with dilated uterus and cervix, and constricted or imperforate vagina. Mutant males have small testes, with few mature germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Ovol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02307:Ovol1 APN 19 5553615 missense possibly damaging 0.55
IGL02874:Ovol1 APN 19 5551181 missense probably damaging 1.00
IGL02974:Ovol1 APN 19 5551149 missense probably damaging 1.00
IGL03157:Ovol1 APN 19 5551607 missense probably benign
R1252:Ovol1 UTSW 19 5553601 missense probably benign
R1611:Ovol1 UTSW 19 5551070 missense probably damaging 1.00
R1662:Ovol1 UTSW 19 5551639 missense probably damaging 0.98
R4728:Ovol1 UTSW 19 5553662 nonsense probably null
R5966:Ovol1 UTSW 19 5551602 missense probably damaging 1.00
R7020:Ovol1 UTSW 19 5560233 missense probably damaging 1.00
R7567:Ovol1 UTSW 19 5551586 missense probably damaging 0.99
R8185:Ovol1 UTSW 19 5551514 missense probably damaging 1.00
RF016:Ovol1 UTSW 19 5553612 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGCTAAACGAGTCTGCG -3'
(R):5'- CTTCCTGGAACCCTGATAGATC -3'

Sequencing Primer
(F):5'- CTAAACGAGTCTGCGAAAGTC -3'
(R):5'- GGAACCCTGATAGATCTTTTCTGCAC -3'
Posted On2019-10-07