Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Rasgrf1'

57761

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf1

Ensembl Gene

ENSMUSG00000032356

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 1

Synonyms

CDC25, Grfbeta, CDC25Mm, Grf1

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0629 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

89909908-90026977 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89984269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 587 (V587M)

Ref Sequence

ENSEMBL: ENSMUSP00000034912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034912]

AlphaFold

P27671

PDB Structure

Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034912
AA Change: V587M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: V587M

Domain	Start	End	E-Value	Type
PH	23	132	2.48e-18	SMART
Blast:RhoGEF	146	196	4e-6	BLAST
IQ	205	227	5.27e0	SMART
RhoGEF	248	429	1.96e-57	SMART
PH	461	590	1.51e-8	SMART
RasGEFN	634	767	3.07e-10	SMART
low complexity region	844	855	N/A	INTRINSIC
RasGEFN	869	997	5.86e-7	SMART
RasGEF	1023	1260	1.85e-99	SMART

Meta Mutation Damage Score

0.1011

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Rasgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Rasgrf1	APN	9	89970481	missense	probably damaging	1.00
IGL00763:Rasgrf1	APN	9	89971020	missense	probably benign	0.05
IGL01336:Rasgrf1	APN	9	89991530	missense	probably benign	0.00
IGL01710:Rasgrf1	APN	9	89991692	missense	probably benign	0.18
IGL01807:Rasgrf1	APN	9	89991513	missense	probably damaging	0.99
IGL01939:Rasgrf1	APN	9	89974836	missense	probably damaging	0.99
IGL02453:Rasgrf1	APN	9	89944760	missense	possibly damaging	0.76
IGL02961:Rasgrf1	APN	9	89981649	missense	possibly damaging	0.88
IGL03009:Rasgrf1	APN	9	89991703	missense	possibly damaging	0.75
IGL03369:Rasgrf1	APN	9	90010451	missense	probably damaging	1.00
IGL03373:Rasgrf1	APN	9	90017031	splice site	probably benign
Malenkiy	UTSW	9	90010484	splice site	probably null
Pigeon	UTSW	9	89967915	missense	probably damaging	1.00
PIT4142001:Rasgrf1	UTSW	9	89915573	missense	possibly damaging	0.91
R0234:Rasgrf1	UTSW	9	90009366	missense	probably damaging	1.00
R0685:Rasgrf1	UTSW	9	89915482	utr 3 prime	probably benign
R0730:Rasgrf1	UTSW	9	89951009	splice site	probably benign
R0835:Rasgrf1	UTSW	9	90000771	missense	probably benign
R1432:Rasgrf1	UTSW	9	90012800	missense	probably benign	0.35
R1647:Rasgrf1	UTSW	9	89953920	missense	probably benign	0.28
R1717:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R1933:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R1934:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R2187:Rasgrf1	UTSW	9	89994835	missense	possibly damaging	0.93
R2240:Rasgrf1	UTSW	9	89976762	missense	probably damaging	0.99
R2940:Rasgrf1	UTSW	9	89991714	missense	possibly damaging	0.84
R3949:Rasgrf1	UTSW	9	89981744	splice site	probably benign
R4751:Rasgrf1	UTSW	9	89910118	missense	probably damaging	1.00
R4751:Rasgrf1	UTSW	9	90012866	missense	probably damaging	1.00
R4901:Rasgrf1	UTSW	9	89995003	missense	probably benign	0.00
R4910:Rasgrf1	UTSW	9	89976752	missense	probably benign	0.00
R4961:Rasgrf1	UTSW	9	89944869	missense	probably benign	0.06
R5270:Rasgrf1	UTSW	9	90026694	missense	probably benign	0.00
R5320:Rasgrf1	UTSW	9	90020425	missense	probably damaging	0.99
R5602:Rasgrf1	UTSW	9	89911571	missense	possibly damaging	0.73
R5659:Rasgrf1	UTSW	9	89984289	missense	probably damaging	1.00
R5960:Rasgrf1	UTSW	9	90021384	missense	possibly damaging	0.69
R6074:Rasgrf1	UTSW	9	89953915	missense	probably benign	0.01
R6400:Rasgrf1	UTSW	9	89991630	missense	probably damaging	1.00
R6596:Rasgrf1	UTSW	9	90012794	missense	possibly damaging	0.92
R6603:Rasgrf1	UTSW	9	89910257	missense	probably damaging	0.96
R6647:Rasgrf1	UTSW	9	90010463	missense	probably benign	0.00
R6813:Rasgrf1	UTSW	9	90010484	splice site	probably null
R7136:Rasgrf1	UTSW	9	89991598	missense	probably damaging	1.00
R7155:Rasgrf1	UTSW	9	90002361	missense	possibly damaging	0.90
R7175:Rasgrf1	UTSW	9	89980749	missense	probably benign	0.02
R7202:Rasgrf1	UTSW	9	90017072	missense	possibly damaging	0.49
R7219:Rasgrf1	UTSW	9	89984288	missense	probably damaging	1.00
R7244:Rasgrf1	UTSW	9	89994757	missense	probably damaging	1.00
R7733:Rasgrf1	UTSW	9	89981727	missense	probably benign	0.01
R7764:Rasgrf1	UTSW	9	89994694	missense	possibly damaging	0.94
R8210:Rasgrf1	UTSW	9	89911622	missense	unknown
R8421:Rasgrf1	UTSW	9	89967915	missense	probably damaging	1.00
R8524:Rasgrf1	UTSW	9	89915585	missense	possibly damaging	0.53
R8526:Rasgrf1	UTSW	9	89974848	missense	probably damaging	0.96
R8697:Rasgrf1	UTSW	9	89995002	missense	probably benign
R9133:Rasgrf1	UTSW	9	89911547	missense	probably benign
R9153:Rasgrf1	UTSW	9	89944737	missense	probably damaging	1.00
R9191:Rasgrf1	UTSW	9	90001870	missense	probably damaging	1.00
R9349:Rasgrf1	UTSW	9	90002407	missense	probably damaging	0.99
R9468:Rasgrf1	UTSW	9	89998703	missense	probably benign	0.00
R9498:Rasgrf1	UTSW	9	89944868	missense	probably benign
R9747:Rasgrf1	UTSW	9	89994994	missense	probably benign
R9779:Rasgrf1	UTSW	9	89991498	missense	probably damaging	0.99
Z1177:Rasgrf1	UTSW	9	89950917	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACACTGGCTTCAAAGAGTGACC -3'
(R):5'- TGAAATGAATCCCCAGCATCTTCCC -3'

Sequencing Primer
(F):5'- gtcaagtcagtcccccaag -3'
(R):5'- AGCATCTTCCCAGTTCCAGAG -3'

Posted On

2013-07-11