Incidental Mutation 'R0629:Rasgrf1'
ID57761
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene NameRAS protein-specific guanine nucleotide-releasing factor 1
SynonymsCDC25, Grfbeta, CDC25Mm, Grf1
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score221
Status Validated
Chromosome9
Chromosomal Location89909908-90026977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89984269 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 587 (V587M)
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034912]
PDB Structure
Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034912
AA Change: V587M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: V587M

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89970481 missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89971020 missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89991530 missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89991692 missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89991513 missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89974836 missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89944760 missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89981649 missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89991703 missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 90010451 missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 90017031 splice site probably benign
Malenkiy UTSW 9 90010484 splice site probably null
PIT4142001:Rasgrf1 UTSW 9 89915573 missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 90009366 missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89915482 utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89951009 splice site probably benign
R0835:Rasgrf1 UTSW 9 90000771 missense probably benign
R1432:Rasgrf1 UTSW 9 90012800 missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89953920 missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89994835 missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89976762 missense probably damaging 0.99
R2940:Rasgrf1 UTSW 9 89991714 missense possibly damaging 0.84
R3949:Rasgrf1 UTSW 9 89981744 splice site probably benign
R4751:Rasgrf1 UTSW 9 89910118 missense probably damaging 1.00
R4751:Rasgrf1 UTSW 9 90012866 missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89995003 missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89976752 missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89944869 missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 90026694 missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 90020425 missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89911571 missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89984289 missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 90021384 missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89953915 missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89991630 missense probably damaging 1.00
R6596:Rasgrf1 UTSW 9 90012794 missense possibly damaging 0.92
R6603:Rasgrf1 UTSW 9 89910257 missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 90010463 missense probably benign 0.00
R6813:Rasgrf1 UTSW 9 90010484 splice site probably null
R7136:Rasgrf1 UTSW 9 89991598 missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 90002361 missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89980749 missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 90017072 missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89984288 missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89994757 missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89981727 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACACTGGCTTCAAAGAGTGACC -3'
(R):5'- TGAAATGAATCCCCAGCATCTTCCC -3'

Sequencing Primer
(F):5'- gtcaagtcagtcccccaag -3'
(R):5'- AGCATCTTCCCAGTTCCAGAG -3'
Posted On2013-07-11