Incidental Mutation 'R7449:Sh3pxd2a'
ID577610
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2a
Ensembl Gene ENSMUSG00000053617
Gene NameSH3 and PX domains 2A
SynonymsTks5, Fish, Sh3md1, 2310014D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47260174-47464411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47267652 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 904 (T904S)
Ref Sequence ENSEMBL: ENSMUSP00000080325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]
Predicted Effect probably benign
Transcript: ENSMUST00000081619
AA Change: T904S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: T904S

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111800
AA Change: T876S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: T876S

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Sh3pxd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Sh3pxd2a APN 19 47314155 missense probably benign 0.20
IGL01606:Sh3pxd2a APN 19 47268596 missense probably benign
IGL02001:Sh3pxd2a APN 19 47273447 missense probably damaging 0.99
IGL02060:Sh3pxd2a APN 19 47373378 splice site probably benign
IGL02830:Sh3pxd2a APN 19 47283078 missense probably damaging 1.00
IGL03240:Sh3pxd2a APN 19 47268026 missense probably damaging 1.00
IGL03263:Sh3pxd2a APN 19 47314043 missense probably damaging 1.00
IGL03290:Sh3pxd2a APN 19 47424516 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0504:Sh3pxd2a UTSW 19 47267747 missense probably damaging 1.00
R0683:Sh3pxd2a UTSW 19 47267511 missense probably benign 0.04
R0726:Sh3pxd2a UTSW 19 47268762 missense probably damaging 1.00
R0883:Sh3pxd2a UTSW 19 47268207 missense probably damaging 1.00
R1276:Sh3pxd2a UTSW 19 47268383 missense probably benign
R1349:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1372:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1525:Sh3pxd2a UTSW 19 47278425 missense probably damaging 1.00
R1661:Sh3pxd2a UTSW 19 47278320 missense probably damaging 1.00
R1664:Sh3pxd2a UTSW 19 47268382 missense probably benign 0.02
R1766:Sh3pxd2a UTSW 19 47273250 missense probably benign 0.01
R1931:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R1932:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R2024:Sh3pxd2a UTSW 19 47267264 missense probably benign 0.35
R2165:Sh3pxd2a UTSW 19 47278355 missense probably damaging 1.00
R2210:Sh3pxd2a UTSW 19 47267343 missense possibly damaging 0.93
R2567:Sh3pxd2a UTSW 19 47424569 missense possibly damaging 0.94
R4097:Sh3pxd2a UTSW 19 47424512 missense probably damaging 1.00
R4466:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R4788:Sh3pxd2a UTSW 19 47314079 missense probably damaging 1.00
R4885:Sh3pxd2a UTSW 19 47268693 missense probably damaging 1.00
R4939:Sh3pxd2a UTSW 19 47278404 missense probably damaging 1.00
R5184:Sh3pxd2a UTSW 19 47273411 missense possibly damaging 0.90
R5340:Sh3pxd2a UTSW 19 47268231 missense probably benign 0.36
R5673:Sh3pxd2a UTSW 19 47268666 missense probably damaging 1.00
R5925:Sh3pxd2a UTSW 19 47267612 missense probably damaging 1.00
R5988:Sh3pxd2a UTSW 19 47364638 missense probably benign 0.16
R6120:Sh3pxd2a UTSW 19 47267409 missense probably damaging 0.99
R6432:Sh3pxd2a UTSW 19 47269927 missense probably damaging 0.99
R6650:Sh3pxd2a UTSW 19 47268224 missense probably benign 0.00
R6700:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R6831:Sh3pxd2a UTSW 19 47283093 missense probably damaging 1.00
R7015:Sh3pxd2a UTSW 19 47268123 missense probably benign 0.00
R7225:Sh3pxd2a UTSW 19 47267389 missense probably damaging 1.00
R7695:Sh3pxd2a UTSW 19 47267831 missense probably damaging 1.00
R7904:Sh3pxd2a UTSW 19 47320314 missense possibly damaging 0.54
R8143:Sh3pxd2a UTSW 19 47268699 missense probably damaging 1.00
R8268:Sh3pxd2a UTSW 19 47267594 missense probably benign
R8290:Sh3pxd2a UTSW 19 47314136 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47268707 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47269838 missense probably null 0.72
V3553:Sh3pxd2a UTSW 19 47267219 missense probably benign 0.12
X0013:Sh3pxd2a UTSW 19 47267864 missense probably benign 0.01
X0026:Sh3pxd2a UTSW 19 47464150 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAAACACAGATTGGGGCCTG -3'
(R):5'- AGGTTCTGCGGACATCATCC -3'

Sequencing Primer
(F):5'- ACTTGCCGGACCCCGTTC -3'
(R):5'- CTATCAGAAGGTCCAGGACTCG -3'
Posted On2019-10-07