Mutagenetix > Incidental Mutation

Incidental Mutation 'R7450:Slc9a2'

577612

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R7450 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to G at 40681835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably benign
Transcript: ENSMUST00000027231

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192345

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	A	5: 113,184,111	R746W	possibly damaging	Het
Abcc2	T	C	19: 43,822,039	L925P	probably damaging	Het
Abcc3	A	T	11: 94,361,695	H787Q	probably damaging	Het
Acly	A	T	11: 100,479,275	V987E	probably damaging	Het
Cacna1b	A	T	2: 24,635,135	Y1676*	probably null	Het
Ccdc175	T	A	12: 72,155,673	I283F	possibly damaging	Het
Cfap46	A	T	7: 139,617,437	F2173I	unknown	Het
Cln6	G	A	9: 62,850,630	E224K	probably damaging	Het
Cyp1a1	T	A	9: 57,702,132	L372Q	probably damaging	Het
Dirc2	T	C	16: 35,768,974	I90V	possibly damaging	Het
Dnah8	T	A	17: 30,787,191	I3694N	probably damaging	Het
Dnal1	T	C	12: 84,124,523	Y31H	probably benign	Het
Eid3	T	A	10: 82,866,903	M66K	probably benign	Het
Epo	T	A	5: 137,483,235	E143D	probably damaging	Het
Fbxo25	C	A	8: 13,931,235	N236K	probably benign	Het
Fsip2	A	G	2: 82,951,680	I266V	probably benign	Het
Galnt6	T	C	15: 100,697,815	Y444C	probably damaging	Het
Gm14139	A	G	2: 150,193,126	T456A	probably benign	Het
Gm8251	A	G	1: 44,058,773	V1055A	probably benign	Het
Gna11	T	C	10: 81,532,522	Y160C		Het
Hectd4	A	T	5: 121,281,932	T647S	probably benign	Het
Hgd	T	C	16: 37,624,324	V316A	possibly damaging	Het
Idh3a	T	C	9: 54,596,083	V142A	probably damaging	Het
Il3ra	T	A	14: 14,351,090	I297N	probably benign	Het
Kcnj5	T	G	9: 32,322,195	I275L	possibly damaging	Het
Kdm7a	A	T	6: 39,143,251	L928Q	probably damaging	Het
Kmo	A	G	1: 175,639,100	I75V	probably benign	Het
Krtap1-3	C	A	11: 99,590,871	C150F	unknown	Het
Lingo3	C	A	10: 80,834,837	E420*	probably null	Het
Lrrc37a	A	G	11: 103,498,326	V2091A	probably benign	Het
N4bp2	T	A	5: 65,825,300	Y1632*	probably null	Het
Nlrp1a	C	A	11: 71,107,658	G905V	probably damaging	Het
Nlrp9c	T	A	7: 26,364,939	E988V	probably benign	Het
Nol8	T	G	13: 49,660,015	H179Q	probably benign	Het
Notch3	G	A	17: 32,141,391	P1522L	possibly damaging	Het
Nup210l	T	C	3: 90,115,188		probably null	Het
Oas1b	T	A	5: 120,821,256	Y234*	probably null	Het
Olfr109	C	A	17: 37,466,616	Q137K	probably benign	Het
Olfr1150-ps1	A	C	2: 87,846,459	K63Q	probably damaging	Het
Olfr129	T	C	17: 38,055,109	I152M	probably benign	Het
Olfr271-ps1	T	A	4: 52,936,113	K57*	probably null	Het
Olfr786	A	C	10: 129,437,429	M206L	probably benign	Het
Pag1	T	C	3: 9,699,539	T185A	probably damaging	Het
Palmd	A	T	3: 116,927,643	S100T	probably damaging	Het
Papln	C	A	12: 83,780,171	A690E	probably benign	Het
Pcdhga7	C	T	18: 37,716,026	T362M	probably benign	Het
Pmpcb	T	A	5: 21,746,985	V286E	possibly damaging	Het
Pon3	T	C	6: 5,236,940	I142M	possibly damaging	Het
Prdx6	A	G	1: 161,241,816	S194P	probably benign	Het
Rapgef2	T	C	3: 79,173,059	E112G	probably benign	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rps6kb1	T	A	11: 86,502,831	E491V	probably benign	Het
Sema3d	C	T	5: 12,584,934	Q656*	probably null	Het
Shisa6	A	T	11: 66,218,006	D348E	probably benign	Het
Slc16a7	G	T	10: 125,228,051	H472Q	probably benign	Het
Smad4	A	G	18: 73,677,853	V20A	probably damaging	Het
Spata5	T	C	3: 37,456,785	L697S	probably damaging	Het
Sstr3	G	A	15: 78,539,843	R235W	probably damaging	Het
Svep1	T	A	4: 58,064,248	H3245L	possibly damaging	Het
Tra2a	G	A	6: 49,250,985	R70*	probably null	Het
Trav7-4	G	T	14: 53,461,467	V24L	probably benign	Het
Tsc2	C	A	17: 24,600,031	S1278I	probably damaging	Het
Ubtf	A	G	11: 102,306,649	S726P	unknown	Het
Vmn2r42	A	T	7: 8,184,221	Y851N	probably benign	Het
Wwp1	A	G	4: 19,640,016	Y509H	probably damaging	Het
Xirp2	A	C	2: 67,509,815	Q800P	possibly damaging	Het
Zc3h7b	T	C	15: 81,783,080	F609L	probably benign	Het
Zdhhc8	G	T	16: 18,225,171	H388Q	probably benign	Het
Zfp644	T	C	5: 106,638,526	K52E	probably benign	Het
Zfp82	T	G	7: 30,056,895	E254A	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAACAGCGGCTCTTGGTC -3'
(R):5'- TAATCCAGGGTGAACACGGG -3'

Sequencing Primer
(F):5'- CTGTAGCTGCCAGGCATG -3'
(R):5'- ACCACACTGGCAGGACTTG -3'

Posted On

2019-10-07