Incidental Mutation 'R7450:Cacna1b'
ID577616
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Namecalcium channel, voltage-dependent, N type, alpha 1B subunit
Synonymsalpha(1B), Cav2.2, Cchn1a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7450 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24603887-24763152 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24635135 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1676 (Y1676*)
Ref Sequence ENSEMBL: ENSMUSP00000037416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]
Predicted Effect probably null
Transcript: ENSMUST00000041342
AA Change: Y1676*
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: Y1676*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070864
AA Change: Y1673*
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: Y1673*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100348
AA Change: Y1677*
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: Y1677*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102939
AA Change: Y1674*
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: Y1674*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114447
AA Change: Y1677*
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: Y1677*

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125798
AA Change: Y53*
Predicted Effect probably benign
Transcript: ENSMUST00000155356
SMART Domains Protein: ENSMUSP00000116674
Gene: ENSMUSG00000004113

DomainStartEndE-ValueType
Pfam:GPHH 23 93 5.4e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Ccdc175 T A 12: 72,155,673 I283F possibly damaging Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Gna11 T C 10: 81,532,522 Y160C Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Notch3 G A 17: 32,141,391 P1522L possibly damaging Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc16a7 G T 10: 125,228,051 H472Q probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zc3h7b T C 15: 81,783,080 F609L probably benign Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24651200 nonsense probably null
IGL00508:Cacna1b APN 2 24657289 critical splice donor site probably null
IGL01085:Cacna1b APN 2 24678994 missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24685782 missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24679095 missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24657292 missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24658528 missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24632035 unclassified probably benign
IGL01750:Cacna1b APN 2 24654395 missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24609890 missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24661757 missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24639137 missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24635095 critical splice donor site probably null
IGL01987:Cacna1b APN 2 24697567 splice site probably null
IGL02096:Cacna1b APN 2 24678915 missense probably benign 0.01
IGL02111:Cacna1b APN 2 24606991 missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24616815 splice site probably null
IGL03084:Cacna1b APN 2 24609932 missense probably benign
IGL03184:Cacna1b APN 2 24658489 critical splice donor site probably null
IGL03202:Cacna1b APN 2 24651112 missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24650572 missense probably benign 0.00
IGL03402:Cacna1b APN 2 24762809 missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24631941 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24638657 unclassified probably benign
R0265:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24625232 intron probably benign
R0376:Cacna1b UTSW 2 24659003 splice site probably benign
R0383:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24687704 missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24649989 splice site probably benign
R0660:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24697603 missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24687745 unclassified probably null
R1445:Cacna1b UTSW 2 24718136 splice site probably benign
R1446:Cacna1b UTSW 2 24706177 missense probably benign 0.01
R1496:Cacna1b UTSW 2 24678035 missense probably benign
R1614:Cacna1b UTSW 2 24690807 missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24606709 missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24616879 missense probably null 0.80
R1984:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1989:Cacna1b UTSW 2 24721374 missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24650546 missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24679473 missense probably benign 0.07
R2196:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24685804 missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24606620 missense probably benign 0.01
R2570:Cacna1b UTSW 2 24606637 nonsense probably null
R2850:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24607541 unclassified probably null
R2937:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R2938:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R3522:Cacna1b UTSW 2 24763043 missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24658959 missense probably benign 0.15
R4166:Cacna1b UTSW 2 24677911 missense probably benign 0.32
R4300:Cacna1b UTSW 2 24635239 missense probably damaging 1.00
R4366:Cacna1b UTSW 2 24702620 missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24654430 missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24626852 nonsense probably null
R4673:Cacna1b UTSW 2 24631944 missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24732325 missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24618318 missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24657366 missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24648523 missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R5109:Cacna1b UTSW 2 24690785 missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24732328 missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24635131 missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24719952 missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24733959 missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24706216 missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24650426 critical splice donor site probably null
R5568:Cacna1b UTSW 2 24607600 missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24650554 missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24679358 missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24730796 missense probably damaging 1.00
R6294:Cacna1b UTSW 2 24719057 missense possibly damaging 0.94
R6609:Cacna1b UTSW 2 24653049 missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24632010 missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24762848 missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24690761 missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24700022 missense probably benign 0.06
R7401:Cacna1b UTSW 2 24679294 missense probably benign 0.00
R7402:Cacna1b UTSW 2 24607659 missense probably benign 0.21
R7442:Cacna1b UTSW 2 24607501 missense probably benign
R7481:Cacna1b UTSW 2 24616862 missense probably damaging 0.99
R7792:Cacna1b UTSW 2 24677965 missense probably damaging 0.99
Z1088:Cacna1b UTSW 2 24661844 missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24733945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGGTTTCACTGAACTGCC -3'
(R):5'- ATCCAGAAGAGGAGGCTTCC -3'

Sequencing Primer
(F):5'- TCACTGAACTGCCTTAGACAATGG -3'
(R):5'- CTTTCAAGGGCTCTGCTGGC -3'
Posted On2019-10-07