Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Trak1'

57764

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

MMRRC Submission

038818-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.331) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121367167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 22 (T22S)

Ref Sequence

ENSEMBL: ENSMUSP00000147805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000209211] [ENSMUST00000210636] [ENSMUST00000210798] [ENSMUST00000211301] [ENSMUST00000211439]

AlphaFold

Q6PD31

Predicted Effect

probably benign
Transcript: ENSMUST00000045903
AA Change: T22S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: T22S

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209211
AA Change: T22S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209390

Predicted Effect

probably benign
Transcript: ENSMUST00000210636
AA Change: T22S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000210798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211149

Predicted Effect

probably benign
Transcript: ENSMUST00000211301

Predicted Effect

probably benign
Transcript: ENSMUST00000211439

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211699

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3888:Trak1	UTSW	9	121442797	splice site	probably null
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5467:Trak1	UTSW	9	121446798	missense	probably damaging	1.00
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R7999:Trak1	UTSW	9	121460425	missense	probably damaging	1.00
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null
R8914:Trak1	UTSW	9	121443781	missense	unknown
R9072:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9073:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9312:Trak1	UTSW	9	121451691	missense	probably benign	0.01
R9366:Trak1	UTSW	9	121472512	missense	probably damaging	1.00
R9663:Trak1	UTSW	9	121391858	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TGCCCATCAGAAAGGCTTCTCTCC -3'
(R):5'- TGAGAGTAAGTAGCGTCCAGCTCC -3'

Sequencing Primer
(F):5'- ACGTAATCCACTGTGCGTC -3'
(R):5'- ATCATTCAACACGGTAATTCCTC -3'

Posted On

2013-07-11