Incidental Mutation 'R0629:Vipr1'
ID57765
Institutional Source Beutler Lab
Gene Symbol Vipr1
Ensembl Gene ENSMUSG00000032528
Gene Namevasoactive intestinal peptide receptor 1
SynonymsVPAC1, VIP-R1, VIP receptor subtype 1
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0629 (G1)
Quality Score140
Status Validated
Chromosome9
Chromosomal Location121642716-121672954 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 121660171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 99 (Y99*)
Ref Sequence ENSEMBL: ENSMUSP00000035115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035115]
Predicted Effect probably null
Transcript: ENSMUST00000035115
AA Change: Y99*
SMART Domains Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: Y99*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
HormR 59 131 7.38e-26 SMART
Pfam:7tm_2 140 386 1.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213272
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Vipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vipr1 APN 9 121665178 missense probably damaging 0.99
IGL01779:Vipr1 APN 9 121664630 missense probably damaging 1.00
IGL01809:Vipr1 APN 9 121661440 missense possibly damaging 0.70
IGL02250:Vipr1 APN 9 121665189 missense probably benign 0.10
IGL02677:Vipr1 APN 9 121660283 splice site probably benign
bernalillo UTSW 9 121664618 missense probably damaging 1.00
R0036:Vipr1 UTSW 9 121660983 missense probably benign
R0514:Vipr1 UTSW 9 121658049 missense probably damaging 1.00
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1766:Vipr1 UTSW 9 121661419 missense possibly damaging 0.87
R1884:Vipr1 UTSW 9 121665864 missense possibly damaging 0.56
R1945:Vipr1 UTSW 9 121668474 missense probably damaging 1.00
R1945:Vipr1 UTSW 9 121668475 missense probably damaging 1.00
R2366:Vipr1 UTSW 9 121665184 missense probably benign 0.19
R4275:Vipr1 UTSW 9 121664618 missense probably damaging 1.00
R4600:Vipr1 UTSW 9 121665136 splice site probably null
R5012:Vipr1 UTSW 9 121658045 critical splice acceptor site probably null
R6190:Vipr1 UTSW 9 121664653 missense probably damaging 1.00
R6376:Vipr1 UTSW 9 121664574 missense probably damaging 1.00
R6473:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R6476:Vipr1 UTSW 9 121669423 missense probably benign 0.28
R6641:Vipr1 UTSW 9 121669565 makesense probably null
R6752:Vipr1 UTSW 9 121653893 missense probably damaging 0.99
R7189:Vipr1 UTSW 9 121664554 missense probably damaging 0.97
R7371:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R7419:Vipr1 UTSW 9 121661473 missense probably damaging 0.97
R7647:Vipr1 UTSW 9 121653839 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTACACAGACCAGAGTCTTTCTGCC -3'
(R):5'- ACCTTGTTAGAGGAGCCAGGGATG -3'

Sequencing Primer
(F):5'- GCAGTGACATCTGCTGAGTC -3'
(R):5'- CAGGGATGGGTCTTGGGC -3'
Posted On2013-07-11